cell division cycle 42 (CDC42) - coding DNA reference sequence

(used for variant description)

(last modified February 10, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_001791.3 in the CDC42 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering CDC42 transcript NM_001791.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5046
               acttccgcgggcacccaactgtgcgtctcctgcgcgctgacgtcag       c.-121

 .         .         .         .         .         .                g.5106
 gtgcgtgcccctgtccggcagccgaggagaccccgcgcagtgctgccaacgccccggtgg       c.-61

 .          | 02        .         .         .         .             g.30852
 agaagctgag | gtcatcatcagatttgaaatatttaaagtggatacaaaactatttcagca    c.-1

          .         .         .         .         .         .       g.30912
 ATGCAGACAATTAAGTGTGTTGTTGTGGGCGATGGTGCTGTTGGTAAAACATGTCTCCTG       c.60
 M  Q  T  I  K  C  V  V  V  G  D  G  A  V  G  K  T  C  L  L         p.20

          .         .         .         .      | 03  .         .    g.34110
 ATATCCTACACAACAAACAAATTTCCATCGGAATATGTACCGACT | GTTTTTGACAACTAT    c.120
 I  S  Y  T  T  N  K  F  P  S  E  Y  V  P  T   | V  F  D  N  Y      p.40

          .         .         .         .         .         | 04    g.38814
 GCAGTCACAGTTATGATTGGTGGAGAACCATATACTCTTGGACTTTTTGATACTGCAG | GG    c.180
 A  V  T  V  M  I  G  G  E  P  Y  T  L  G  L  F  D  T  A  G |       p.60

          .         .         .         .         .         .       g.38874
 CAAGAGGATTATGACAGATTACGACCGCTGAGTTATCCACAAACAGATGTATTTCTAGTC       c.240
 Q  E  D  Y  D  R  L  R  P  L  S  Y  P  Q  T  D  V  F  L  V         p.80

          .         .         .         .         | 05         .    g.39054
 TGTTTTTCAGTGGTCTCTCCATCTTCATTTGAAAACGTGAAAGAAAAG | TGGGTGCCTGAG    c.300
 C  F  S  V  V  S  P  S  S  F  E  N  V  K  E  K   | W  V  P  E      p.100

          .         .         .         .         .         .       g.39114
 ATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACTCAAATTGATCTCAGA       c.360
 I  T  H  H  C  P  K  T  P  F  L  L  V  G  T  Q  I  D  L  R         p.120

          .         .         .         .         .         .       g.39174
 GATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATCACTCCAGAG       c.420
 D  D  P  S  T  I  E  K  L  A  K  N  K  Q  K  P  I  T  P  E         p.140

          .         .         .         .         .         .       g.39234
 ACTGCTGAAAAGCTGGCCCGTGACCTGAAGGCTGTCAAGTATGTGGAGTGTTCTGCACTT       c.480
 T  A  E  K  L  A  R  D  L  K  A  V  K  Y  V  E  C  S  A  L         p.160

        | 06 .         .         .         .         .         .    g.43855
 ACACAG | AAAGGCCTAAAGAATGTATTTGACGAAGCAATATTGGCTGCCCTGGAGCCTCCA    c.540
 T  Q   | K  G  L  K  N  V  F  D  E  A  I  L  A  A  L  E  P  P      p.180

          .         .         .                                     g.43891
 GAACCGAAGAAGAGCCGCAGGTGTGTGCTGCTATGA                               c.576
 E  P  K  K  S  R  R  C  V  L  L  X                                 p.191

          .         .         .         .         .         .       g.43951
 acatctctccagagccctttctgcacagctggtgtcggcatcatactaaaagcaatgttt       c.*60

          .         .         .         .         .         .       g.44011
 aaatcaaactaaagattaaaaattaaaattcgtttttgcaataatgacaaatgccctgca       c.*120

          .         .         .         .         .         .       g.44071
 cctacccacatgcactcgtgtgagacaaggcccataggtatggccccccccttccccctc       c.*180

          .         .         .         .         .         .       g.44131
 ccagtactagttaattttgagtaattgtattgtcagaaaagtgattagtactattttttt       c.*240

          .         .         .         .         .         .       g.44191
 ttgttgtttcaaaaaaaaaatttttgtgtgtgtgtgttttttttttttttttttttgttg       c.*300

          .         .         .         .         .         .       g.44251
 tttaaaagcaaggcatgcttgtggatgactctgtaacagactaattggaattgttgaagc       c.*360

          .         .         .         .         .         .       g.44311
 tgctccctggttccactctggagagtaatctgggacatcttagtgttttgttttgttttt       c.*420

          .         .         .         .         .         .       g.44371
 ttccctcctcttttttttgggggggagtgtgtgtggggtttgttttttagtcttgttttt       c.*480

          .         .         .         .         .         .       g.44431
 ttaattcattaaccagtggttagcccttaaggggaggaggacggattgattccacattcc       c.*540

          .         .         .         .         .         .       g.44491
 acttcctagatctagtttagaaaacatgttccccatctggtgctcttaggaaggagtata       c.*600

          .         .         .         .         .         .       g.44551
 gtaaatgcctcatttaataacatactcctttttgaaagttgccttttctctccacccttg       c.*660

          .         .         .         .         .         .       g.44611
 agtagatccagtatttgatgaaactcatgaaagtgggtggagcccatcttgcccctcctc       c.*720

          .         .         .         .         .         .       g.44671
 ttttctaggacgcactatatgtgactgtgactttcaaggacatttgtttgccatttgctg       c.*780

          .         .         .         .         .         .       g.44731
 atttttttgggaagttaatttctaacttctttcactgataaatgaagaaaagtattgcac       c.*840

          .         .         .         .         .         .       g.44791
 ctttgaaatgcaccaaatgaattgagtttgtaattaaaaaaatttttttccctttcagtc       c.*900

          .         .         .         .         .         .       g.44851
 attgtcttatatgcttagcatagatttgcagctcagtagtatatggtgttcctagaatgc       c.*960

          .         .         .         .         .         .       g.44911
 agctgaagacctgttatgtagaggaaatacgaggggtggtgctagaagacagacatctgt       c.*1020

          .         .         .         .         .         .       g.44971
 ggaatgattcacatcctctcaagttaggaggatggaggcctgcttcattaagaagctggg       c.*1080

          .         .         .         .         .         .       g.45031
 ggtagggtgggggtggggagaacacttaacaacatggggaccagtcaggggaatcccctt       c.*1140

          .         .         .         .         .         .       g.45091
 atttctgttttgcatatgaggaaccctagagcagccaggtgaggctctctagtttaataa       c.*1200

          .         .         .         .         .         .       g.45151
 aaatcatggaaagactcttaatgcagactcttcttaagtgttaatagggattttttcagc       c.*1260

          .         .         .         .         .         .       g.45211
 ttattttggttgcagtttccaatttttaaaaatgttgaggtaatctttcccaccttccca       c.*1320

          .         .         .         .         .         .       g.45271
 aacctaattcttgtagatgcattagtgttgaaccaatgctttctcatgtctcaattcttt       c.*1380

          .         .         .         .                           g.45317
 gtatatgcattcttttcagatgtattaaacaaacaaaaacccttca                     c.*1426

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Cell division cycle 42 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.