cyclin-dependent kinase inhibitor 2A (CDKN2A) - coding DNA reference sequence

(used for variant description)

(last modified December 10, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_000077.4 in the CDKN2A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007485.1, covering CDKN2A transcript NM_000077.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.24364
                                                       cgaggg       c.-301

 .         .         .         .         .         .                g.24424
 ctgcttccggctggtgcccccgggggagacccaacctggggcgacttcaggggtgccaca       c.-241

 .         .         .         .         .         .                g.24484
 ttcgctaagtgctcggagttaatagcacctcctccgagcactcgctcacggcgtcccctt       c.-181

 .         .         .         .         .         .                g.24544
 gcctggaaagataccgcggtccctccagaggatttgagggacagggtcggagggggctct       c.-121

 .         .         .         .         .         .                g.24604
 tccgccagcaccggaggaagaaagaggaggggctggctggtcaccagagggtggggcgga       c.-61

 .         .         .         .         .         .                g.24664
 ccgcgtgcgctcggcggctgcggagagggggagagcaggcagcgggcggcggggagcagc       c.-1

          .         .         .         .         .         .       g.24724
 ATGGAGCCGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCG       c.60
 M  E  P  A  A  G  S  S  M  E  P  S  A  D  W  L  A  T  A  A         p.20

          .         .         .         .         .         .       g.24784
 GCCCGGGGTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCA       c.120
 A  R  G  R  V  E  E  V  R  A  L  L  E  A  G  A  L  P  N  A         p.40

          .         .         . | 02       .         .         .    g.28313
 CCGAATAGTTACGGTCGGAGGCCGATCCAG | GTCATGATGATGGGCAGCGCCCGAGTGGCG    c.180
 P  N  S  Y  G  R  R  P  I  Q   | V  M  M  M  G  S  A  R  V  A      p.60

          .         .         .         .         .         .       g.28373
 GAGCTGCTGCTGCTCCACGGCGCGGAGCCCAACTGCGCCGACCCCGCCACTCTCACCCGA       c.240
 E  L  L  L  L  H  G  A  E  P  N  C  A  D  P  A  T  L  T  R         p.80

          .         .         .         .         .         .       g.28433
 CCCGTGCACGACGCTGCCCGGGAGGGCTTCCTGGACACGCTGGTGGTGCTGCACCGGGCC       c.300
 P  V  H  D  A  A  R  E  G  F  L  D  T  L  V  V  L  H  R  A         p.100

          .         .         .         .         .         .       g.28493
 GGGGCGCGGCTGGACGTGCGCGATGCCTGGGGCCGTCTGCCCGTGGACCTGGCTGAGGAG       c.360
 G  A  R  L  D  V  R  D  A  W  G  R  L  P  V  D  L  A  E  E         p.120

          .         .         .         .         .         .       g.28553
 CTGGGCCATCGCGATGTCGCACGGTACCTGCGCGCGGCTGCGGGGGGCACCAGAGGCAGT       c.420
 L  G  H  R  D  V  A  R  Y  L  R  A  A  A  G  G  T  R  G  S         p.140

          .         .         .        | 03.         .              g.31272
 AACCATGCCCGCATAGATGCCGCGGAAGGTCCCTCAG | ACATCCCCGATTGA             c.471
 N  H  A  R  I  D  A  A  E  G  P  S  D |   I  P  D  X               p.156

          .         .         .         .         .         .       g.31332
 aagaaccagagaggctctgagaaacctcgggaaacttagatcatcagtcaccgaaggtcc       c.*60

          .         .         .         .         .         .       g.31392
 tacagggccacaactgcccccgccacaacccaccccgctttcgtagttttcatttagaaa       c.*120

          .         .         .         .         .         .       g.31452
 atagagcttttaaaaatgtcctgccttttaacgtagatatatgccttcccccactaccgt       c.*180

          .         .         .         .         .         .       g.31512
 aaatgtccatttatatcattttttatatattcttataaaaatgtaaaaaagaaaaacacc       c.*240

          .         .         .         .         .         .       g.31572
 gcttctgccttttcactgtgttggagttttctggagtgagcactcacgccctaagcgcac       c.*300

          .         .         .         .         .         .       g.31632
 attcatgtgggcatttcttgcgagcctcgcagcctccggaagctgtcgacttcatgacaa       c.*360

          .         .         .         .         .         .       g.31692
 gcattttgtgaactagggaagctcaggggggttactggcttctcttgagtcacactgcta       c.*420

          .         .         .         .         .                 g.31749
 gcaaatggcagaaccaaagctcaaataaaaataaaataattttcattcattcactca          c.*477

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Cyclin-dependent kinase inhibitor 2A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.