cyclin-dependent kinase inhibitor 2A (CDKN2A) - coding DNA reference sequence

(used for variant description)

(last modified December 10, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_058195.3 in the CDKN2A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_007485.1, covering CDKN2A transcript NM_058195.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5040
                     cgctcagggaaggcgggtgcgcgcctgcggggcggagatg       c.-121

 .         .         .         .         .         .                g.5100
 ggcagggggcggtgcgtgggtcccagtctgcagttaagggggcaggagtggcgctgctca       c.-61

 .         .         .         .         .         .                g.5160
 cctctggtgccaaagggcggcgcagcggctgccgagctcggccctggaggcggcgagaac       c.-1

          .         .         .         .         .         .       g.5220
 ATGGTGCGCAGGTTCTTGGTGACCCTCCGGATTCGGCGCGCGTGCGGCCCGCCGCGAGTG       c.60
 M  V  R  R  F  L  V  T  L  R  I  R  R  A  C  G  P  P  R  V         p.20

          .         .         .         .         .         .       g.5280
 AGGGTTTTCGTGGTTCACATCCCGCGGCTCACGGGGGAGTGGGCAGCGCCAGGGGCGCCC       c.120
 R  V  F  V  V  H  I  P  R  L  T  G  E  W  A  A  P  G  A  P         p.40

          .         .         .         .         .         .       g.5340
 GCCGCTGTGGCCCTCGTGCTGATGCTACTGAGGAGCCAGCGTCTAGGGCAGCAGCCGCTT       c.180
 A  A  V  A  L  V  L  M  L  L  R  S  Q  R  L  G  Q  Q  P  L         p.60

          .    | 02    .         .         .         .         .    g.28330
 CCTAGAAGACCAG | GTCATGATGATGGGCAGCGCCCGAGTGGCGGAGCTGCTGCTGCTCCA    c.240
 P  R  R  P  G |   H  D  D  G  Q  R  P  S  G  G  A  A  A  A  P      p.80

          .         .         .         .         .         .       g.28390
 CGGCGCGGAGCCCAACTGCGCCGACCCCGCCACTCTCACCCGACCCGTGCACGACGCTGC       c.300
 R  R  G  A  Q  L  R  R  P  R  H  S  H  P  T  R  A  R  R  C         p.100

          .         .         .         .         .         .       g.28450
 CCGGGAGGGCTTCCTGGACACGCTGGTGGTGCTGCACCGGGCCGGGGCGCGGCTGGACGT       c.360
 P  G  G  L  P  G  H  A  G  G  A  A  P  G  R  G  A  A  G  R         p.120

          .         .         .                                     g.28489
 GCGCGATGCCTGGGGCCGTCTGCCCGTGGACCTGGCTGA                            c.399
 A  R  C  L  G  P  S  A  R  G  P  G  X                              p.132

          .         .         .         .         .         .       g.28549
 ggagctgggccatcgcgatgtcgcacggtacctgcgcgcggctgcggggggcaccagagg       c.*60

          .         .         .         .  | 03      .         .    g.31268
 cagtaaccatgcccgcatagatgccgcggaaggtccctcag | acatccccgattgaaagaa    c.*120

          .         .         .         .         .         .       g.31328
 ccagagaggctctgagaaacctcgggaaacttagatcatcagtcaccgaaggtcctacag       c.*180

          .         .         .         .         .         .       g.31388
 ggccacaactgcccccgccacaacccaccccgctttcgtagttttcatttagaaaataga       c.*240

          .         .         .         .         .         .       g.31448
 gcttttaaaaatgtcctgccttttaacgtagatatatgccttcccccactaccgtaaatg       c.*300

          .         .         .         .         .         .       g.31508
 tccatttatatcattttttatatattcttataaaaatgtaaaaaagaaaaacaccgcttc       c.*360

          .         .         .         .         .         .       g.31568
 tgccttttcactgtgttggagttttctggagtgagcactcacgccctaagcgcacattca       c.*420

          .         .         .         .         .         .       g.31628
 tgtgggcatttcttgcgagcctcgcagcctccggaagctgtcgacttcatgacaagcatt       c.*480

          .         .         .         .         .         .       g.31688
 ttgtgaactagggaagctcaggggggttactggcttctcttgagtcacactgctagcaaa       c.*540

          .         .         .         .         .                 g.31740
 tggcagaaccaaagctcaaataaaaataaaataattttcattcattcactca               c.*592

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Cyclin-dependent kinase inhibitor 2A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.