CCAAT/enhancer binding protein (C/EBP), alpha (CEBPA) - coding DNA reference sequence

(used for variant description)

(last modified July 24, 2018)


This file was created to facilitate the description of sequence variants on transcript NM_004364.3 in the CEBPA gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012022.1, covering CEBPA transcript NM_004364.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5050
           cggaggtgcgcgggcgcgggcgagcagggtctccgggtgggcggcggcga       c.-61

 .         .         .         .         .         .                g.5110
 cgccccgcgcaggctggaggccgccgaggctcgccatgccgggagaactctaactccccc       c.-1

          .         .         .         .         .         .       g.5170
 ATGGAGTCGGCCGACTTCTACGAGGCGGAGCCGCGGCCCCCGATGAGCAGCCACCTGCAG       c.60
 M  E  S  A  D  F  Y  E  A  E  P  R  P  P  M  S  S  H  L  Q         p.20

          .         .         .         .         .         .       g.5230
 AGCCCCCCGCACGCGCCCAGCAGCGCCGCCTTCGGCTTTCCCCGGGGCGCGGGCCCCGCG       c.120
 S  P  P  H  A  P  S  S  A  A  F  G  F  P  R  G  A  G  P  A         p.40

          .         .         .         .         .         .       g.5290
 CAGCCTCCCGCCCCACCTGCCGCCCCGGAGCCGCTGGGCGGCATCTGCGAGCACGAGACG       c.180
 Q  P  P  A  P  P  A  A  P  E  P  L  G  G  I  C  E  H  E  T         p.60

          .         .         .         .         .         .       g.5350
 TCCATCGACATCAGCGCCTACATCGACCCGGCCGCCTTCAACGACGAGTTCCTGGCCGAC       c.240
 S  I  D  I  S  A  Y  I  D  P  A  A  F  N  D  E  F  L  A  D         p.80

          .         .         .         .         .         .       g.5410
 CTGTTCCAGCACAGCCGGCAGCAGGAGAAGGCCAAGGCGGCCGTGGGCCCCACGGGCGGC       c.300
 L  F  Q  H  S  R  Q  Q  E  K  A  K  A  A  V  G  P  T  G  G         p.100

          .         .         .         .         .         .       g.5470
 GGCGGCGGCGGCGACTTTGACTACCCGGGCGCGCCCGCGGGCCCCGGCGGCGCCGTCATG       c.360
 G  G  G  G  D  F  D  Y  P  G  A  P  A  G  P  G  G  A  V  M         p.120

          .         .         .         .         .         .       g.5530
 CCCGGGGGAGCGCACGGGCCCCCGCCCGGCTACGGCTGCGCGGCCGCCGGCTACCTGGAC       c.420
 P  G  G  A  H  G  P  P  P  G  Y  G  C  A  A  A  G  Y  L  D         p.140

          .         .         .         .         .         .       g.5590
 GGCAGGCTGGAGCCCCTGTACGAGCGCGTCGGGGCGCCGGCGCTGCGGCCGCTGGTGATC       c.480
 G  R  L  E  P  L  Y  E  R  V  G  A  P  A  L  R  P  L  V  I         p.160

          .         .         .         .         .         .       g.5650
 AAGCAGGAGCCCCGCGAGGAGGATGAAGCCAAGCAGCTGGCGCTGGCCGGCCTCTTCCCT       c.540
 K  Q  E  P  R  E  E  D  E  A  K  Q  L  A  L  A  G  L  F  P         p.180

          .         .         .         .         .         .       g.5710
 TACCAGCCGCCGCCGCCGCCGCCGCCCTCGCACCCGCACCCGCACCCGCCGCCCGCGCAC       c.600
 Y  Q  P  P  P  P  P  P  P  S  H  P  H  P  H  P  P  P  A  H         p.200

          .         .         .         .         .         .       g.5770
 CTGGCCGCCCCGCACCTGCAGTTCCAGATCGCGCACTGCGGCCAGACCACCATGCACCTG       c.660
 L  A  A  P  H  L  Q  F  Q  I  A  H  C  G  Q  T  T  M  H  L         p.220

          .         .         .         .         .         .       g.5830
 CAGCCCGGTCACCCCACGCCGCCGCCCACGCCCGTGCCCAGCCCGCACCCCGCGCCCGCG       c.720
 Q  P  G  H  P  T  P  P  P  T  P  V  P  S  P  H  P  A  P  A         p.240

          .         .         .         .         .         .       g.5890
 CTCGGTGCCGCCGGCCTGCCGGGCCCTGGCAGCGCGCTCAAGGGGCTGGGCGCCGCGCAC       c.780
 L  G  A  A  G  L  P  G  P  G  S  A  L  K  G  L  G  A  A  H         p.260

          .         .         .         .         .         .       g.5950
 CCCGACCTCCGCGCGAGTGGCGGCAGCGGCGCGGGCAAGGCCAAGAAGTCGGTGGACAAG       c.840
 P  D  L  R  A  S  G  G  S  G  A  G  K  A  K  K  S  V  D  K         p.280

          .         .         .         .         .         .       g.6010
 AACAGCAACGAGTACCGGGTGCGGCGCGAGCGCAACAACATCGCGGTGCGCAAGAGCCGC       c.900
 N  S  N  E  Y  R  V  R  R  E  R  N  N  I  A  V  R  K  S  R         p.300

          .         .         .         .         .         .       g.6070
 GACAAGGCCAAGCAGCGCAACGTGGAGACGCAGCAGAAGGTGCTGGAGCTGACCAGTGAC       c.960
 D  K  A  K  Q  R  N  V  E  T  Q  Q  K  V  L  E  L  T  S  D         p.320

          .         .         .         .         .         .       g.6130
 AATGACCGCCTGCGCAAGCGGGTGGAACAGCTGAGCCGCGAACTGGACACGCTGCGGGGC       c.1020
 N  D  R  L  R  K  R  V  E  Q  L  S  R  E  L  D  T  L  R  G         p.340

          .         .         .         .         .                 g.6187
 ATCTTCCGCCAGCTGCCAGAGAGCTCCTTGGTCAAGGCCATGGGCAACTGCGCGTGA          c.1077
 I  F  R  Q  L  P  E  S  S  L  V  K  A  M  G  N  C  A  X            p.358

          .         .         .         .         .         .       g.6247
 ggcgcgcggctgtgggaccgccctgggccagcctccggcggggacccagggagtggtttg       c.*60

          .         .         .         .         .         .       g.6307
 gggtcgccggatctcgaggcttgcccgagccgtgcgagccaggactaggagattccggtg       c.*120

          .         .         .         .         .         .       g.6367
 cctcctgaaagcctggcctgctccgcgtgtcccctcccttcctctgcgccggacttggtg       c.*180

          .         .         .         .         .         .       g.6427
 cgtctaagatgagggggccaggcggtggcttctccctgcgaggaggggagaattcttggg       c.*240

          .         .         .         .         .         .       g.6487
 gctgagctgggagcccggcaactctagtatttaggataaccttgtgccttggaaatgcaa       c.*300

          .         .         .         .         .         .       g.6547
 actcaccgctccaatgcctactgagtagggggagcaaatcgtgccttgtcattttatttg       c.*360

          .         .         .         .         .         .       g.6607
 gaggtttcctgcctccttcccgaggctacagcagacccccatgagagaaggaggggagca       c.*420

          .         .         .         .         .         .       g.6667
 ggcccgtggcaggaggagggctcagggagctgagatcccgacaagcccgccagccccagc       c.*480

          .         .         .         .         .         .       g.6727
 cgctcctccacgcctgtccttagaaaggggtggaaacatagggacttggggcttggaacc       c.*540

          .         .         .         .         .         .       g.6787
 taaggttgttcccctagttctacatgaaggtggagggtctctagttccacgcctctccca       c.*600

          .         .         .         .         .         .       g.6847
 cctccctccgcacacaccccaccccagcctgctataggctgggcttccccttggggcgga       c.*660

          .         .         .         .         .         .       g.6907
 actcactgcgatgggggtcaccaggtgaccagtgggagcccccaccccgagtcacaccag       c.*720

          .         .         .         .         .         .       g.6967
 aaagctaggtcgtgggtcagctctgaggatgtatacccctggtgggagagggagacctag       c.*780

          .         .         .         .         .         .       g.7027
 agatctggctgtggggcgggcatggggggtgaagggccactgggaccctcagccttgttt       c.*840

          .         .         .         .         .         .       g.7087
 gtactgtatgccttcagcattgcctaggaacacgaagcacgatcagtccatcccagaggg       c.*900

          .         .         .         .         .         .       g.7147
 accggagttatgacaagctttccaaatattttgctttatcagccgatatcaacacttgta       c.*960

          .         .         .         .         .         .       g.7207
 tctggcctctgtgccccagcagtgccttgtgcaatgtgaatgtgcgcgtctctgctaaac       c.*1020

          .         .         .         .         .         .       g.7267
 caccattttatttggtttttgttttgttttggttttgctcggatacttgccaaaatgaga       c.*1080

          .         .         .         .         .         .       g.7327
 ctctccgtcggcagctgggggaagggtctgagactccctttccttttggttttgggatta       c.*1140

          .         .         .         .         .         .       g.7387
 cttttgatcctgggggaccaatgaggtgaggggggttctcctttgccctcagctttcccc       c.*1200

          .         .         .         .         .         .       g.7447
 agcccctccggcctgggctgcccacaaggcttgtcccccagaggccctggctcctggtcg       c.*1260

          .         .         .         .         .         .       g.7507
 ggaagggaggtggcctcccgccaacgcatcactggggctgggagcagggaaggacggctt       c.*1320

          .         .         .         .         .         .       g.7567
 ggttctcttcttttggggagaacgtagagtctcactctagatgttttatgtattatatct       c.*1380

          .         .                                               g.7591
 ataatataaacatatcaaagtcaa                                           c.*1404

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The CCAAT/enhancer binding protein (C/EBP), alpha protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center