cofilin 2 (muscle) (CFL2) - coding DNA reference sequence

(used for variant description)

(last modified January 20, 2019)


This file was created to facilitate the description of sequence variants in the CFL2 gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_012740.1, covering transcript variant 2 (NM_138638.4). Intron 1 contains an alternative promoter /exon 01b, used in transcript variant 1 (NM_021914.7). Exon 02 sometimes uses an alternatively splice donor site, encoding a truncated protein.

Please note that introns are available by clicking on the exon numbers above the sequence.


 (upstream sequence)
                     .         .         .         .                g.5043
                  cgcgctctgaggtcaggccgaggacgcggacagccggggagcc       c.-241

 .         .         .         .         .         .                g.5103
 ggggccgcgagacagaagggccggcctgggagcgggtggcgccggctggggaccaggcgt       c.-181

 .         .         .         .         .         .                g.5163
 gcccacgtgaccgccccgcccgctgcctgcggcccgccgagccccgccacctccctcggg       c.-121

 .         .         .         .         .         .                g.5223
 ctgcagctcccggcgtgccccgcactctccgctgcccacccgctcgcccgcccctccttc       c.-61

 .         .         .         .         .         .                g.5283
 tcctcccagtgccacagagccgaagcccgagctgccgccgcagccacagccgagggcact       c.-1

     | 02    .         .         .         .         .       |    .    g.6319
 ATG | GCTTCTGGAGTTACAGTGAATGATGAAGTCATCAAAGTTTTTAATGATATGAAA | GTA    c.60
 M   | A  S  G  V  T  V  N  D  E  V  I  K  V  F  N  D  M  K  V      p.20
alternative exon 02 splice donor site in some transcripts ^ . . . . . . g.6379 AGGAAATCTTCTACACAAGAGGAGATCAAAAAGAGAAAGAAAGCAGTTCTCTTCTGTTTA c.120 R K S S T Q E E I K K R K K A V L F C L p.40 . . . . . . g.6439 AGCGATGACAAAAGACAAATAATTGTAGAGGAAGCAAAGCAGATCTTGGTGGGTGACATT c.180 S D D K R Q I I V E E A K Q I L V G D I p.60 . . . . . . g.6499 GGTGATACTGTAGAGGACCCCTACACATCTTTTGTGAAGTTGCTACCTCTGAATGATTGC c.240 G D T V E D P Y T S F V K L L P L N D C p.80 . . . . . . g.6559 CGATATGCTTTGTACGATGCCACATACGAAACAAAAGAGTCTAAGAAAGAAGACCTAGTA c.300 R Y A L Y D A T Y E T K E S K K E D L V p.100 . | 03 . . . . . g.6736 TTTATATTCTG | GGCTCCTGAAAGTGCACCTTTAAAAAGCAAGATGATTTATGCTAGCTCT c.360 F I F W | A P E S A P L K S K M I Y A S S p.120 . . | 04 . . . g.6878 AAAGATGCCATTAAAAAGAAATTTACAG | GTATTAAACATGAGTGGCAAGTAAATGGCTTG c.420 K D A I K K K F T G | I K H E W Q V N G L p.140 . . . . . . g.6938 GATGATATTAAGGACCGTTCGACACTTGGAGAGAAATTGGGAGGCAATGTAGTAGTTTCA c.480 D D I K D R S T L G E K L G G N V V V S p.160 . . g.6959 CTTGAAGGAAAACCATTATAA c.501 L E G K P L X p.166 . . . . . . g.7019 aatgacagtcaagtgccatctggatcttaaggagcttccatttctccagctcagtccatt c.*60 . . . . . . g.7079 ggaatagtattaggttttggttttttgttgtatttccccctttccactgggcccttccaa c.*120 . . . . . . g.7139 cacaatgaatgaaggaaatatcatttatttaagcagcctatcagtgattgccattagact c.*180 . . . . . . g.7199 gttgaatactgttacttttatatagaacccaaggaatgccttcctgtcatattttagcca c.*240 . . . . . . g.7259 aaacaactggttatatgcctcccttgcagcaagcactacaatgtatgtgatcgtcaatgt c.*300 . . . . . . g.7319 gaatagcttagaatactgcaaaggataagctaattgaatgccttgaaagtattatccact c.*360 . . . . . . g.7379 ggtcagatggtcaacttttttcagtattatttatagttggcacttgattgcagttctgtg c.*420 . . . . . . g.7439 aggcttgagcattcatacacctcacctgccttggcaagcctattttagtgatatggcagc c.*480 . . . . . . g.7499 acggatataacactatgcattaaaagcactttttgtaataagtttaatatcctaaaagga c.*540 . . . . . . g.7559 atgccaattaagttttgttaactgtgtcatcaacttatcctagtacctcagtgttcattc c.*600 . . . . . . g.7619 ctgttacctgcatatcttcttaaaagaaatagctgttattaatgcctttttgttttccat c.*660 . . . . . . g.7679 tgagtgtacactactgaataagtgtaggagttttatgtttaccatgtgagtcctgcaaca c.*720 . . . . . . g.7739 ctaaagatattttgaatatcagtcatgatggcaatttctgtataaaagagccttaaatgg c.*780 . . . . . . g.7799 aacattgttttgagatcaaactccccaccctcacaaaaatggccacgttgcaataaaaat c.*840 . . . . . . g.7859 tgtggcatattacagaacgttgccttgttttccttggaaattttgcaaaatgttatgtga c.*900
^ ^ ^ ^ polyA addition sites . . . . . . g.7919 aacaacttctagggtaaaaacagctattactaatctctgcactggtcatttgagaatttt c.*960 . . . . . . g.7979 ttttgtacagcattcatgtgtgatattttccagatttgttggatctatttggtttaaaaa c.*1020 . . . . . . g.8039 gtattctatcttaaggccaactaatataaaataccattgttaaagaatggtacttttata c.*1080 . . . . . . g.8099 aacattagtgtatttatttcctatgtgttaatatgaagatcagaaattattttttgcact c.*1140 . . . . . . g.8159 ttggcataaatacttttcaatatctgatttgttctctggataaattagcatagttatttt c.*1200 . . . . . . g.8219 tttattcacatttacatttctaagtagttgtatagtagaagcaggaagctcttattgctt c.*1260 . . . . . . g.8279 atttggtcgtaatgaaaataatttgtaaaatgtcctttaaaagtttaatgatacttctga c.*1320 . . . . . . g.8339 tgtttcggaacagtcatttcacctactatttctgaatatattttgcaaattgaattggaa c.*1380 . . . . . . g.8399 taggaattgataatagcagtcttaaacattagtagtgggatttggctatggtccagactg c.*1440 . . . . . . g.8459 tgctccttatagagaatttgatctgctcagtgtgagcggtttgctgttagccagggctat c.*1500 . . . . . . g.8519 ttatggcaaacacatgcttttgtatcttgtcatagttatccacaaatggcaaaactggac c.*1560 . . . . . . g.8579 ttgattctactggtatgcaaaacaggcatgctagtaagcagtcagtcgtggctcagaact c.*1620 . . . . . . g.8639 taaccccatagctcagaggaatgcttttagcagaaaacaggaaagaaaatatcccttaaa c.*1680 . . . . . . g.8699 aattttttttgaatgtgtggaagtaattttagtataattagattttttccatatttttga c.*1740 . . . . . . g.8759 aagatttttcagatgtgaacattaaaaatagggattaaatgtctaggcttccatttaaaa c.*1800 . . . . . . g.8819 ttatatgaatggtttgggatctttttgcactgagcaattttatttcaggcttccagctgt c.*1860 . . . . . . g.8879 ccctgtgagttatcctggacatttcgatggtttttggtaaggccaaactctgataagcaa c.*1920 . . . . . . g.8939 aacagagaatactgacgtatacttaaccatatgtgtaactgatacttggcaccatggaat c.*1980 . . . . . . g.8999 ttttcattgagttatttcctcattcttttaaaaaataagggactataaatcagttatgta c.*2040 . . . . . . g.9059 gtatcttttgtttttgtagctgattccttaactttcttgtatgcctctagtaatttcaga c.*2100 . . . . . . g.9119 gattaaatattgctttaaactgtgatactttgatttgctagattgacaaaactgatacta c.*2160 . . . . . . g.9179 atataattaagttcatctttgaaatacatctttgtgcgtagagccaaaaaaagagataaa c.*2220 . . . . . . g.9239 attaataatagttcacttgttatttgagattaatttggcatttgaaatgatcattttatt c.*2280 . . . . . . g.9299 ttacaatcatttataatgaatcaatgttccagttagctttaaaaggtatacggtgctaat c.*2340 . . . . . . g.9359 tagtaaaatattgaaggcaatattttactgctagcttgcaaagttatgagagtttaaaaa c.*2400 . . . . . . g.9419 ataaaatatatgaaaatatgtaaagctgttgagatgtgtttacttatacttcagaacatt c.*2460
^ ^ ^ ^ polyA addition sites . . g.9442 aaaagtttaaaaactggtatttc c.*2483
^ ^ ^ polyA addition sites (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Cofilin 2 (muscle) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2019 Leiden University Medical Center