cholinergic receptor, nicotinic, epsilon (muscle) (CHRNE) - coding DNA reference sequence

(used for variant description)

(last modified January 20, 2019)


This file was created to facilitate the description of sequence variants in the CHRNE gene based on a coding DNA reference sequence following the HGVS recommendations. The sequence was taken from NG_008029.2, covering CHRNE transcript NM_000080.3. The protein is N-terminally cleaved to obtain the mature CHRNE protein, removing the signal peptide (amino acids 1-20). Publications describing variants in CHRNE originally used the mature protein as a reference.

CHRNE intron 8 contains the C17ORF107 gene (transcribed from the other strand). The end of CHRNE gene overlaps with 3' end of the MINK1 gene (transcribed from other strand).

Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5011
                                                  cacgcagcagg       c.-1

          .         .         .         .       | 02 .         .    g.5325
 ATGGCAAGGGCTCCGCTTGGGGTCCTGCTCCTCTTGGGGCTTCTCG | GCAGGGGTGTGGGG    c.60
 M  A  R  A  P  L  G  V  L  L  L  L  G  L  L  G |   R  G  V  G      p.20

          .         .         .         .         .         .       g.5385
 AAGAACGAGGAACTGCGTCTTTATCACCATCTCTTCAACAACTATGACCCAGGAAGCCGG       c.120
 K  N  E  E  L  R  L  Y  H  H  L  F  N  N  Y  D  P  G  S  R         p.40

          .         .         .         .         .         .       g.5445
 CCAGTGCGGGAGCCTGAGGATACTGTCACCATCAGCCTCAAGGTCACCCTGACGAATCTC       c.180
 P  V  R  E  P  E  D  T  V  T  I  S  L  K  V  T  L  T  N  L         p.60

           | 03        .         .         .         .     | 04   . g.5754
 ATCTCACTG | AATGAAAAAGAGGAGACTCTCACCACTAGCGTCTGGATTGGAATC | GATTGG c.240
 I  S  L   | N  E  K  E  E  T  L  T  T  S  V  W  I  G  I   | D  W   p.80

          .         .         .         .         .         .       g.5814
 CAGGATTACCGACTCAACTACAGCAAGGACGACTTTGGGGGTATAGAAACCCTGCGAGTC       c.300
 Q  D  Y  R  L  N  Y  S  K  D  D  F  G  G  I  E  T  L  R  V         p.100

          .         .         .         .     | 05   .         .    g.6003
 CCTTCAGAACTCGTGTGGCTGCCAGAGATTGTGCTGGAAAACAA | TATTGATGGCCAGTTC    c.360
 P  S  E  L  V  W  L  P  E  I  V  L  E  N  N  |  I  D  G  Q  F      p.120

          .         .         .         .         .         .       g.6063
 GGAGTGGCCTACGACGCCAACGTGCTCGTCTACGAGGGCGGCTCCGTGACGTGGCTGCCT       c.420
 G  V  A  Y  D  A  N  V  L  V  Y  E  G  G  S  V  T  W  L  P         p.140

          .         .         .         .         .         .       g.6123
 CCGGCCATCTACCGCAGCGTCTGCGCAGTGGAGGTCACCTACTTCCCCTTCGATTGGCAG       c.480
 P  A  I  Y  R  S  V  C  A  V  E  V  T  Y  F  P  F  D  W  Q         p.160

          .         . | 06       .         .         .         .    g.6489
 AACTGTTCGCTTATTTTCCG | CTCTCAGACGTACAATGCCGAAGAGGTGGAGTTCACTTTT    c.540
 N  C  S  L  I  F  R  |  S  Q  T  Y  N  A  E  E  V  E  F  T  F      p.180

          .         .         .         .         .         .       g.6549
 GCCGTAGACAACGACGGCAAGACCATCAACAAGATCGACATCGACACAGAGGCCTATACT       c.600
 A  V  D  N  D  G  K  T  I  N  K  I  D  I  D  T  E  A  Y  T         p.200

   | 07      .         .         .         .         .         .    g.6943
 G | AGAACGGCGAGTGGGCCATCGACTTCTGCCCGGGGGTGATCCGCCGCCACCACGGTGGC    c.660
 E |   N  G  E  W  A  I  D  F  C  P  G  V  I  R  R  H  H  G  G      p.220

          .         .         .         .         .         .       g.7003
 GCCACCGACGGCCCAGGGGAGACTGACGTCATCTACTCGCTCATCATCCGCCGGAAGCCG       c.720
 A  T  D  G  P  G  E  T  D  V  I  Y  S  L  I  I  R  R  K  P         p.240

          .         .         .         .         .         .       g.7063
 CTCTTCTACGTCATTAACATCATCGTGCCCTGTGTGCTCATCTCGGGCCTGGTGCTGCTC       c.780
 L  F  Y  V  I  N  I  I  V  P  C  V  L  I  S  G  L  V  L  L         p.260

          .         .   | 08     .         .         .         .    g.7205
 GCCTACTTCCTGCCGGCGCAGG | CCGGCGGCCAGAAATGCACGGTCTCCATCAACGTCCTG    c.840
 A  Y  F  L  P  A  Q  A |   G  G  Q  K  C  T  V  S  I  N  V  L      p.280

          .         .         .         .         .         .       g.7265
 CTCGCCCAGACCGTCTTCTTGTTCCTCATTGCCCAGAAAATCCCAGAGACTTCTCTGAGC       c.900
 L  A  Q  T  V  F  L  F  L  I  A  Q  K  I  P  E  T  S  L  S         p.300

          .        | 09.         .         .         .         .    g.8535
 GTGCCGCTCCTGGGCAG | GTTCCTTATTTTCGTCATGGTGGTCGCCACGCTCATTGTCATG    c.960
 V  P  L  L  G  R  |  F  L  I  F  V  M  V  V  A  T  L  I  V  M      p.320
^ intron contains C17ORF107 gene . . . . . . g.8595 AATTGCGTCATCGTGCTCAACGTGTCCCAGCGGACGCCCACCACCCACGCCATGTCCCCG c.1020 N C V I V L N V S Q R T P T T H A M S P p.340 . | 10 . . . . . g.8738 CGGCTGCGCCAC | GTTCTCCTGGAGCTGCTGCCGCGCCTCCTGGGCTCCCCGCCGCCGCCC c.1080 R L R H | V L L E L L P R L L G S P P P P p.360 . . . . . . g.8798 GAGGCCCCCCGGGCCGCCTCGCCCCCAAGGCGGGCGTCGTCGGTGGGCTTATTGCTCCGC c.1140 E A P R A A S P P R R A S S V G L L L R p.380 . . . . . . g.8858 GCGGAGGAGCTGATACTGAAAAAGCCACGGAGCGAGCTCGTGTTTGAGGGGCAGAGGCAC c.1200 A E E L I L K K P R S E L V F E G Q R H p.400 . | 11 . . . . g.9008 CGGCAGGGGACCTGGACGG | CTGCCTTCTGCCAGAGCCTGGGCGCCGCCGCCCCCGAGGTC c.1260 R Q G T W T A | A F C Q S L G A A A P E V p.420 . . . . . . g.9068 CGCTGCTGTGTGGATGCCGTGAACTTCGTGGCCGAGAGCACGAGAGATCAGGAGGCCACC c.1320 R C C V D A V N F V A E S T R D Q E A T p.440 | 12 . . . . . . g.9237 GGCGAG | GAAGTGTCCGACTGGGTGCGCATGGGGAATGCCCTTGACAACATCTGCTTCTGG c.1380 G E | E V S D W V R M G N A L D N I C F W p.460 . . . . . . g.9297 GCCGCTCTGGTGCTCTTCAGCGTGGGCTCCAGCCTCATCTTCCTCGGGGCCTACTTCAAC c.1440 A A L V L F S V G S S L I F L G A Y F N p.480 . . . . g.9339 CGAGTGCCTGATCTCCCCTACGCGCCGTGTATCCAGCCTTAG c.1482 R V P D L P Y A P C I Q P X p.493 . . . . . . g.9399 ctcgcaccgacttcaatttcccacccatctccagtaggaaattgattttgaaaaagtagg c.*60 . . . . . . g.9459 ctgccgccaccacggcattatgatcccttccccctgctgatcaatctgcagtttgtgaac c.*120 . . . . . . g.9519 ttcacaagaatggtgtgtgcccgttccctggcgtgtgtaggcctggccgcagtccagggg c.*180 . . . . . . g.9579 tcagcaggaggaaagggttcacataggctctcaggtgccagtcttccagaaagcaaggac c.*240 . . . . . . g.9639 tgcccttcattcagccttgctgacctcccagcctttctaaggctcagccccacgggactc c.*300 . . . . . . g.9699 tggtggctgccagcttgtgagctatctatctatattcatttcatagccaaacaggagacc c.*360 . . . . . . g.9759 cctttgcaggacttgcacacagggaggctgtagccaggaaaccctcttcttccctggtct c.*420 . . . . . . g.9819 ggctctgctggagcgggtgggaaccaaacaccttcagtgctggtggccctcaggcccaca c.*480 . . . . . . g.9879 ggtttaaggctgaggctgccctgacccttccacagtcatttcttctaggttttcttggcc c.*540 . . . . . . g.9939 cagcactgcccatcccaccccatgaggctcactcattgcagatcccagcccaccctgccc c.*600 . . . . . . g.9999 ctttcttccccaccctggaggctctctctgcctagtctacagtactgacagaaagcaagg c.*660 . . . . . . g.10059 acatgcggcctgcat ggtgggagctggttgaattgtctttattaacaaacaggatatcca c.*720 ^ 3'end / polyA addition site MINK1 gene (transcribed from other strand) . . . . . . g.10119 aggccactacattgaggaggggtggggggggagggagaagggttacttgctgctcacact c.*780 . . . . . . g.10179 atatacagatgcaagcaaggggcgtggagagtgagggctccctgctccctccctccaccg c.*840 . . . . . . g.10239 gggaagggcatgggctagaagaggagaggggggtcgggaatggggggaatgttttggctg c.*900 . . . . . . g.10299 gcggggtcccccctccattccctggagtttgggggaaggggaatcattaaagtgctttca c.*960 g.10306 gaaaatg c.*967 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Cholinergic receptor, nicotinic, epsilon (muscle) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2019 Leiden University Medical Center