calcium and integrin binding 1 (calmyrin) (CIB1) - coding DNA reference sequence

(used for variant description)

(last modified September 16, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_006384.3 in the CIB1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000015.9, covering CIB1 transcript NM_006384.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5042
                   ggctgggaacgcctggcagcttttaggagggggcgggcccgg       c.-121

 .         .         .         .         .         .                g.5102
 gggtggtggccccaggagcggttgccgcggggaccgggcagtgacgcggcccaagggcgg       c.-61

 .         .         .         .         .         .                g.5162
 aagtgagaaagttgtctgcgtctcgaggcgagttggcggagctgtgcgcgcggcggggcg       c.-1

          .         .         .         .         .  | 02      .    g.5353
 ATGGGGGGCTCGGGCAGTCGCCTGTCCAAGGAGCTGCTGGCCGAGTACCAG | GACTTGACG    c.60
 M  G  G  S  G  S  R  L  S  K  E  L  L  A  E  Y  Q   | D  L  T      p.20

          .         .       | 03 .         .         .         .    g.6754
 TTCCTGACGAAGCAGGAGATCCTCCT | AGCCCACAGGCGGTTTTGTGAGCTGCTTCCCCAG    c.120
 F  L  T  K  Q  E  I  L  L  |  A  H  R  R  F  C  E  L  L  P  Q      p.40

          .         .         .         .         .         .       g.6814
 GAGCAGCGGAGCGTGGAGTCGTCACTTCGGGCACAAGTGCCCTTCGAGCAGATTCTCAGC       c.180
 E  Q  R  S  V  E  S  S  L  R  A  Q  V  P  F  E  Q  I  L  S         p.60

          .      | 04  .         .         .         .         .    g.7585
 CTTCCAGAGCTCAAG | GCCAACCCCTTCAAGGAGCGAATCTGCAGGGTCTTCTCCACATCC    c.240
 L  P  E  L  K   | A  N  P  F  K  E  R  I  C  R  V  F  S  T  S      p.80

          .         .         .         .         .         .       g.7645
 CCAGCCAAAGACAGCCTTAGCTTTGAGGACTTCCTGGATCTCCTCAGTGTGTTCAGTGAC       c.300
 P  A  K  D  S  L  S  F  E  D  F  L  D  L  L  S  V  F  S  D         p.100

          .         .         .         .       | 05 .         .    g.7848
 ACAGCCACGCCAGACATCAAGTCCCATTATGCCTTCCGCATCTTTG | ACTTTGATGATGAC    c.360
 T  A  T  P  D  I  K  S  H  Y  A  F  R  I  F  D |   F  D  D  D      p.120

          .         .         .         .         .         .       g.7908
 GGAACCTTGAACAGAGAAGACCTGAGCCGGCTGGTGAACTGCCTCACGGGAGAGGGCGAG       c.420
 G  T  L  N  R  E  D  L  S  R  L  V  N  C  L  T  G  E  G  E         p.140

          .         .         .         .      | 06  .         .    g.8040
 GACACACGGCTTAGTGCGTCTGAGATGAAGCAGCTCATCGACAAC | ATCCTGGAGGAGTCT    c.480
 D  T  R  L  S  A  S  E  M  K  Q  L  I  D  N   | I  L  E  E  S      p.160

          .         .         .         .         .         .       g.8100
 GACATTGACAGGGATGGAACCATCAACCTCTCTGAGTTCCAGCACGTCATCTCCCGTTCT       c.540
 D  I  D  R  D  G  T  I  N  L  S  E  F  Q  H  V  I  S  R  S         p.180

          .     | 07   .         .                                  g.8588
 CCAGACTTTGCCAG | CTCCTTTAAGATTGTCCTGTGA                            c.576
 P  D  F  A  S  |  S  F  K  I  V  L  X                              p.191

          .         .         .         .         .         .       g.8648
 cagcagccccagcgtgtgtcctggcaccctgtccaagaacctttctactgctgagctgtg       c.*60

          .         .         .         .         .         .       g.8708
 gccaaggtcaagcctgtgttgccagtgcgggccaagctggcccagcctggagctggcgct       c.*120

          .         .         .         .         .         .       g.8768
 gtgcagcctcaccccgggcaggggcggccctcgttgtcagggcctctcctcactgctgtt       c.*180

          .         .         .         .         .                 g.8827
 gtcattgctccgtttgtgtttgtactaatcagtaataaaggtttagaagtttgacccta        c.*239

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Calcium and integrin binding 1 (calmyrin) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.