calcium and integrin binding family member 2 (CIB2) - coding DNA reference sequence

(used for variant description)

(last modified November 11, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_006383.3 in the CIB2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_033006.1, covering CIB2 transcript NM_006383.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5021
                                         aagggttcgtgccgggcagc       c.-301

 .         .         .         .         .         .                g.5081
 gtctcccggggccaggtcgcctcctgccgggacccgggcgcgctgcagccgcggagccgg       c.-241

 .         .         .         .         .         .                g.5141
 gtgccccgccctcttcccgccggcggcggagtcgctgccgctccgggttcccgtccccgc       c.-181

 .         .         .         .         .         .                g.5201
 ctccgagacccccgcgcgcctcctccaggcgagctgcggggcgggaagggtccggccacc       c.-121

 .         .         .         .         .         .                g.5261
 gtgggccgctgccagccgcggggctgccgagggccgcgggcacggggcgctggctccggg       c.-61

 .         .         .         .         .         .                g.5321
 tctggcggccgctgatgggagtcggagcccgggcgggcgagcggcggcgcggcggccacc       c.-1

          .         .         .         .         .  | 02      .    g.12806
 ATGGGGAACAAGCAGACCATCTTCACCGAAGAGCAGCTAGACAACTACCAG | GACTGCACC    c.60
 M  G  N  K  Q  T  I  F  T  E  E  Q  L  D  N  Y  Q   | D  C  T      p.20

          .         .       | 03 .         .         .         .    g.25294
 TTCTTCAATAAGAAGGACATCCTCAA | GCTGCATTCGCGATTCTATGAGCTGGCCCCCAAC    c.120
 F  F  N  K  K  D  I  L  K  |  L  H  S  R  F  Y  E  L  A  P  N      p.40

          .         .         .         .         .         .       g.25354
 CTCGTCCCAATGGACTACAGGAAGAGCCCCATCGTCCACGTGCCCATGAGCCTCATCATC       c.180
 L  V  P  M  D  Y  R  K  S  P  I  V  H  V  P  M  S  L  I  I         p.60

          .         | 04         .         .         .         .    g.27196
 CAGATGCCAGAGCTCCGG | GAGAATCCCTTCAAAGAAAGGATCGTGGCGGCGTTTTCCGAG    c.240
 Q  M  P  E  L  R   | E  N  P  F  K  E  R  I  V  A  A  F  S  E      p.80

          .         .         .         .         .         .       g.27256
 GATGGTGAGGGGAACCTCACTTTCAACGACTTTGTGGACATGTTTTCCGTGCTCTGCGAG       c.300
 D  G  E  G  N  L  T  F  N  D  F  V  D  M  F  S  V  L  C  E         p.100

          .         .         .         .       | 05 .         .    g.30616
 TCGGCTCCCCGAGAGCTCAAGGCAAACTATGCCTTCAAGATCTATG | ACTTCAACACTGAC    c.360
 S  A  P  R  E  L  K  A  N  Y  A  F  K  I  Y  D |   F  N  T  D      p.120

          .         .         .         .         .         .       g.30676
 AACTTCATCTGCAAGGAGGACCTGGAGCTGACGCTGGCCCGGCTCACTAAGTCAGAGCTG       c.420
 N  F  I  C  K  E  D  L  E  L  T  L  A  R  L  T  K  S  E  L         p.140

          .         .         .         .         .         .       g.30736
 GATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGGT       c.480
 D  E  E  E  V  V  L  V  C  D  K  V  I  E  E  A  D  L  D  G         p.160

          .         .         .         .         .         .       g.30796
 GACGGCAAGCTGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTCCTC       c.540
 D  G  K  L  G  F  A  D  F  E  D  M  I  A  K  A  P  D  F  L         p.180

    | 06     .         .                                            g.31262
 AG | CACTTTCCACATCCGGATCTGA                                        c.564
 S  |  T  F  H  I  R  I  X                                          p.187

          .         .         .         .         .         .       g.31322
 ggacactgccgaggctgtaggggcctagaagtccaccatcctgccctgcagtcacatggg       c.*60

          .         .         .         .         .         .       g.31382
 tgtggcctccaagctccccaggaaagcagtggcagcctctggggtttacaccacaaatat       c.*120

          .         .         .         .         .         .       g.31442
 atcctgtggccctttcagcaaaaaaaaaaccttaaccaggaagggggcctgtgaaggtta       c.*180

          .         .         .         .         .         .       g.31502
 ggacccttcccacagccccgctgtggtccagccccgggacccatggcctctctccaggcc       c.*240

          .         .         .         .         .         .       g.31562
 ctccgcaccccgccccatgccccagtcctttcctactccagaaatgctccccaccccccc       c.*300

          .         .         .         .         .         .       g.31622
 aaagagggaaaagcagataacccaacaggaggtggtggggtctgacgtgtccaagtgctg       c.*360

          .         .         .         .         .         .       g.31682
 gcagacaccctggtcacccaggacagagcggaaaaaaaaaaaagaggtcagggttttaac       c.*420

          .         .         .         .         .         .       g.31742
 gagctatgcaatctttttccaaaacccaaggttgggctgcttcccacccctgcctgttcc       c.*480

          .         .         .         .         .         .       g.31802
 ccttctcccggcctccttcacaatgtgaagctgtgggtgcagtgggcccaagggctcttg       c.*540

          .         .         .         .         .         .       g.31862
 ctcctgtctctgcctctgggtcatgagtaccaccctgcctgcctccccaacaccgtggaa       c.*600

          .         .         .         .         .         .       g.31922
 tcctcactggtgtgctgtccacagatttgtgaactcctggtagtaaaacacttttgcatc       c.*660

          .         .         .         .                           g.31967
 cctttgctctccatgtatgctaatgttaggaaatgtttgagggta                      c.*705

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Calcium and integrin binding family member 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.