claudin 14 (CLDN14) - coding DNA reference sequence

(used for variant description)

(last modified September 5, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_001146077.1 in the CLDN14 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011777.1, covering CLDN14 transcript NM_001146077.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5018
                                           ggggagggcaagctggga       c.-361

 .         .         .         .         .         .                g.5078
 aaagctgagagaggcaggcagcccagccaggcagaagtcacgagccaggcacctgccaag       c.-301

 .         .         .         .         .         .                g.5138
 agagggagtaagatgttcaagaggagctccggaagaactttcagatatagcactggactt       c.-241

 .         .         . | 02       .         .         .             g.71108
 ggctgaggacacagcagcacg | gggctgcaaggcccagagatctggacacaagccaagaag    c.-181

 .         .         .         .         .         .                g.71168
 tcaagaactgttgaagccgcagtctccactctcctactgacaccagagaccacccagccc       c.-121

 .         .         .         .         | 03         .             g.119814
 agccaaaccatatggcctcttgttttcctgatgtatgag | ggctccggctggcacctgagg    c.-61

 .         .         .         .         .         .                g.119874
 agcggcgtgaccccgagggcccagggagctgcccggctggcctaggcaggcagccgcacc       c.-1

          .         .         .         .         .         .       g.119934
 ATGGCCAGCACGGCCGTGCAGCTTCTGGGCTTCCTGCTCAGCTTCCTGGGCATGGTGGGC       c.60
 M  A  S  T  A  V  Q  L  L  G  F  L  L  S  F  L  G  M  V  G         p.20

          .         .         .         .         .         .       g.119994
 ACGTTGATCACCACCATCCTGCCGCACTGGCGGAGGACAGCGCACGTGGGCACCAACATC       c.120
 T  L  I  T  T  I  L  P  H  W  R  R  T  A  H  V  G  T  N  I         p.40

          .         .         .         .         .         .       g.120054
 CTCACGGCCGTGTCCTACCTGAAAGGGCTCTGGATGGAGTGTGTGTGGCACAGCACAGGC       c.180
 L  T  A  V  S  Y  L  K  G  L  W  M  E  C  V  W  H  S  T  G         p.60

          .         .         .         .         .         .       g.120114
 ATCTACCAGTGCCAGATCTACCGATCCCTGCTGGCGCTGCCCCAAGACCTCCAGGCTGCC       c.240
 I  Y  Q  C  Q  I  Y  R  S  L  L  A  L  P  Q  D  L  Q  A  A         p.80

          .         .         .         .         .         .       g.120174
 CGCGCCCTCATGGTCATCTCCTGCCTGCTCTCGGGCATAGCCTGCGCCTGCGCCGTCATC       c.300
 R  A  L  M  V  I  S  C  L  L  S  G  I  A  C  A  C  A  V  I         p.100

          .         .         .         .         .         .       g.120234
 GGGATGAAGTGCACGCGCTGCGCCAAGGGCACACCCGCCAAGACCACCTTTGCCATCCTC       c.360
 G  M  K  C  T  R  C  A  K  G  T  P  A  K  T  T  F  A  I  L         p.120

          .         .         .         .         .         .       g.120294
 GGCGGCACCCTCTTCATCCTGGCCGGCCTCCTGTGCATGGTGGCCGTCTCCTGGACCACC       c.420
 G  G  T  L  F  I  L  A  G  L  L  C  M  V  A  V  S  W  T  T         p.140

          .         .         .         .         .         .       g.120354
 AACGACGTGGTGCAGAACTTCTACAACCCGCTGCTGCCCAGCGGCATGAAGTTTGAGATT       c.480
 N  D  V  V  Q  N  F  Y  N  P  L  L  P  S  G  M  K  F  E  I         p.160

          .         .         .         .         .         .       g.120414
 GGCCAGGCCCTGTACCTGGGCTTCATCTCCTCGTCCCTCTCGCTCATTGGTGGCACCCTG       c.540
 G  Q  A  L  Y  L  G  F  I  S  S  S  L  S  L  I  G  G  T  L         p.180

          .         .         .         .         .         .       g.120474
 CTTTGCCTGTCCTGCCAGGACGAGGCACCCTACAGGCCCTACCAGGCCCCGCCCAGGGCC       c.600
 L  C  L  S  C  Q  D  E  A  P  Y  R  P  Y  Q  A  P  P  R  A         p.200

          .         .         .         .         .         .       g.120534
 ACCACGACCACTGCAAACACCGCACCTGCCTACCAGCCACCAGCTGCCTACAAAGACAAT       c.660
 T  T  T  T  A  N  T  A  P  A  Y  Q  P  P  A  A  Y  K  D  N         p.220

          .         .         .         .         .         .       g.120594
 CGGGCCCCCTCAGTGACCTCGGCCACGCACAGCGGGTACAGGCTGAACGACTACGTGTGA       c.720
 R  A  P  S  V  T  S  A  T  H  S  G  Y  R  L  N  D  Y  V  X         p.239

          .         .         .         .         .         .       g.120654
 gtccccacagcctgcttctcccctgggctgctgtgggctgggtccccggcgggactgtca       c.*60

          .         .         .         .         .         .       g.120714
 atggaggcaggggttccagcacaaagtttacttctgggcaatttttgtatccaaggaaat       c.*120

          .         .         .         .         .         .       g.120774
 aatgtgaatgcgaggaaatgtctttagagcacagggacagagggggaaataagaggagga       c.*180

          .         .         .         .         .         .       g.120834
 gaaagctctctataccaaagactgaaaaaaaaaatcctgtctgtttttgtatttattata       c.*240

          .         .         .         .         .         .       g.120894
 tatatttatgtgggtgatttgataacaagtttaatataaagtgacttgggagtttggtca       c.*300

          .         .         .         .         .                 g.120949
 gtggggttggtttgtgatccaggaataaaccttgcggatgtggctgtttatgaaa            c.*355

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Claudin 14 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.