claudin 9 (CLDN9) - coding DNA reference sequence

(used for variant description)

(last modified December 4, 2023)

This file was created to facilitate the description of sequence variants on transcript NM_020982.3 in the CLDN9 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering CLDN9 transcript NM_020982.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5007
                                                      cagattc       c.-901

 .         .         .         .         .         .                g.5067
 cagagagtcccaggcgggcgggagtgtgcgatactcggggagctggggcatgtttgcatc       c.-841

 .         .         .         .         .         .                g.5127
 acgaaactcggctgggggagagcagaggcagctggggaggggctgcggaaggaggaggct       c.-781

 .         .         .         .         .         .                g.5187
 caggaaggcaagccgacgccccctgtgtgtgtttctgtcctgagcctgttacttttttga       c.-721

 .         .         .         .         .         .                g.5247
 cccccgatccgtctcttcttcctcagcttgtcctccatcttcccctcctttacccttggt       c.-661

 .         .         .         .         .         .                g.5307
 tcccacatgcacagatgctacggacgcttttcctcccctgtccccactcagccgcagcat       c.-601

 .         .         .         .         .         .                g.5367
 cccccgctggcccccaggcccctcatccatccgctgcccacgaacccccagccccgcacc       c.-541

 .         .         .         .         .         .                g.5427
 ctccccgtggctcaggtctcccctatcccggcctccctgcacttcactctgctcctcccc       c.-481

 .         .         .         .         .         .                g.5487
 tgcctgggccttaaaaccccgcctgcagccgagagcccgcagagtccccaggtggcactg       c.-421

 .         .         .         .         .         .                g.5547
 tcagagtcgctcagtgggaacctgcgccagccggcaggagacgtggctgtcctcagcctg       c.-361

 .         .         .         .         .         .                g.5607
 gcagtgcgtctggagggcctgtgcgagctcagcccaggtgtgacagcggggtggtaagag       c.-301

 .         .         .         .         .         .                g.5667
 cagcagcaccctcagggcatccgatgggcggaggcccctcgaggtgacacccaccactca       c.-241

 .         .         .         .         .         .                g.5727
 gccgagcgggactacgagtctgctttgtgctccgcgaggaccagaaacacctgcaagagg       c.-181

 .         .         .         .         .         .                g.5787
 cacggagaggaggcgcctttcaagaggcgcctttcatggaactgaggactggcctggctt       c.-121

 .         .         .         .         .         .                g.5847
 ggggacaccaacaagccttccccctcctgctggacacagagacacccacccagcacacca       c.-61

 .         .         .         .         .         .                g.5907
 gacacaccctctgagtcacctaggccgcctggggctgagaagacctaaccgaggggccag       c.-1

          .         .         .         .         .         .       g.5967
 ATGGCTTCGACCGGCTTAGAACTGCTGGGCATGACCCTGGCTGTGCTGGGCTGGCTGGGG       c.60
 M  A  S  T  G  L  E  L  L  G  M  T  L  A  V  L  G  W  L  G         p.20

          .         .         .         .         .         .       g.6027
 ACCCTGGTGTCCTGCGCCCTGCCCCTGTGGAAGGTGACCGCCTTCATCGGCAACAGCATC       c.120
 T  L  V  S  C  A  L  P  L  W  K  V  T  A  F  I  G  N  S  I         p.40

          .         .         .         .         .         .       g.6087
 GTGGTGGCCCAGGTGGTGTGGGAGGGCCTGTGGATGTCCTGCGTGGTGCAGAGCACGGGC       c.180
 V  V  A  Q  V  V  W  E  G  L  W  M  S  C  V  V  Q  S  T  G         p.60

          .         .         .         .         .         .       g.6147
 CAGATGCAGTGCAAGGTGTACGACTCACTGCTGGCTCTGCCGCAGGACCTGCAGGCCGCA       c.240
 Q  M  Q  C  K  V  Y  D  S  L  L  A  L  P  Q  D  L  Q  A  A         p.80

          .         .         .         .         .         .       g.6207
 CGTGCCCTCTGTGTCATTGCCCTCCTGCTGGCCCTGCTTGGCCTCCTGGTGGCCATCACA       c.300
 R  A  L  C  V  I  A  L  L  L  A  L  L  G  L  L  V  A  I  T         p.100

          .         .         .         .         .         .       g.6267
 GGTGCCCAGTGTACCACGTGTGTGGAGGACGAAGGTGCCAAGGCCCGTATCGTGCTCACC       c.360
 G  A  Q  C  T  T  C  V  E  D  E  G  A  K  A  R  I  V  L  T         p.120

          .         .         .         .         .         .       g.6327
 GCGGGGGTCATCCTCCTCCTCGCCGGCATCCTGGTGCTCATCCCTGTGTGCTGGACGGCG       c.420
 A  G  V  I  L  L  L  A  G  I  L  V  L  I  P  V  C  W  T  A         p.140

          .         .         .         .         .         .       g.6387
 CACGCCATCATCCAGGACTTCTACAACCCCCTGGTGGCTGAGGCCCTCAAGCGGGAGCTG       c.480
 H  A  I  I  Q  D  F  Y  N  P  L  V  A  E  A  L  K  R  E  L         p.160

          .         .         .         .         .         .       g.6447
 GGGGCCTCCCTCTACCTGGGCTGGGCGGCGGCTGCACTGCTTATGCTGGGCGGGGGGCTC       c.540
 G  A  S  L  Y  L  G  W  A  A  A  A  L  L  M  L  G  G  G  L         p.180

          .         .         .         .         .         .       g.6507
 CTCTGCTGCACGTGCCCCCCGCCCCAGGTCGAGCGGCCCCGCGGACCTCGGCTGGGCTAC       c.600
 L  C  C  T  C  P  P  P  Q  V  E  R  P  R  G  P  R  L  G  Y         p.200

          .         .         .         .         .                 g.6561
 TCCATCCCCTCCCGCTCGGGTGCATCTGGACTGGACAAGAGGGACTACGTGTGA             c.654
 S  I  P  S  R  S  G  A  S  G  L  D  K  R  D  Y  V  X               p.217

          .         .         .         .         .         .       g.6621
 ggcggaggtttcccctgggagcccactgctccccactgccccgccctttcgaccttggcc       c.*60

          .         .         .         .         .         .       g.6681
 tgatgaccagatgccctgctccatcacaacctccttccccaggaaaacccactttccaaa       c.*120

          .         .         .         .         .         .       g.6741
 agcccaagctacacctggctgcagggctgggtcagctggcctggctgagctcttctcagt       c.*180

          .         .         .         .         .         .       g.6801
 ggggtcccctttgatgttctcccccaagttgggcagcctagaggtgttgggaaccctggc       c.*240

          .         .         .         .         .         .       g.6861
 ctgcccccacctccccagtaattgtttccttccgttgcccaggacactggctggccttcc       c.*300

          .         .         .         .         .         .       g.6921
 ttctcttctgagccctcccctgccccaggaaccctggcctcaccaaaacagcagcagctc       c.*360

          .         .         .         .         .         .       g.6981
 gttggctccaaaaccagggagcagaccatgccctcccaaccctggagttgtcagggaggg       c.*420

          .         .         .         .         .         .       g.7041
 cctgcccatcacctccctctccccaacatccccaccctcgagttggaaataaagagcatt       c.*480

                                                                    g.7050
 tgtaactgg                                                          c.*489

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Claudin 9 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.