chloride intracellular channel 2 (CLIC2) - downstream reference sequence


         .            .         .         .         .         . g.63535
aaaaaccttcaa / ttaactcttggtttaaaagaaaaatataaaccaaaactacatgatctc c.*1740

         .         .         .         .         .         .    g.63595
taaaacaaataatgatgatgtaaacacttcatatcagaatccatgggataaatataaagc    c.*1800

         .         .         .         .         .         .    g.63655
agtgatcagaggaaattttataactaaacactgctattagtaaaaataaaagattgaaaa    c.*1860

         .         .         .         .         .         .    g.63715
taaattgattaaatattgaactaacaaaaatttttaaaatgtgcacaacaatgtgaatat    c.*1920

         .         .         .         .         .         .    g.63775
acttgacacttctcaactctctgcttcaaaatagttaaggtgatgagttttaagctatgt    c.*1980

         .         .         .         .         .         .    g.63835
gtttttaacacaacttaaaaaaaaatgtccaaatggatcttggtagagcaccagcaaaaa    c.*2040

         .         .         .         .         .         .    g.63895
acagaaagaaacttagaataagtacaacaaattaagtaaaagaacacaagagattaacaa    c.*2100

         .         .         .         .         .         .    g.63955
aaaaagtaagaattaacaaaagaatagaaatagcatagacctagttaacgaatcaaaacc    c.*2160

         .         .         .         .         .         .    g.64015
tttattttttaaaagattgataatacagacaaaccattagctacattaattgaaataaaa    c.*2220

         .         .         .         .         .         .    g.64075
cagagaaagcaaaagtatgcaaaataaagaatggggaaataactattagaagaaatttaa    c.*2280

         .         .         .         .         .         .    g.64135
gacattataagagactactttgcagacctctgtgcaaacaaatttcaaaatctagatgat    c.*2340

         .         .         .         .         .         .    g.64195
agagataatttcctagcaaagtaaagattacgaaaaacaactttattagagatatgaaaa    c.*2400

         .         .         .         .         .         .    g.64255
ttgaagagctcaatcttcatagaagaaagagagaacattttttaaaaagaagaaatagag    c.*2460

         .         .         .         .         .         .    g.64315
aaaattataaggaactacttaccaaaaagtatcaatccccagatagtttcacagggaaat    c.*2520

         .         .         .         .         .         .    g.64375
gctaccaaactttaaaagaccatatagtctcaaagtaactttgcgaaacagtgtttcttc    c.*2580

         .         .         .         .         .         .    g.64435
tggaaaatataaaacaaaatataaagaaactatacataaatattgtactctaattggcaa    c.*2640

         .         .         .         .         .         .    g.64495
agttgtttctcaaggggatatgtgtagacaattctgaaacagccatacatgtatactaag    c.*2700

         .         .         .         .         .         .    g.64555
attgaaaaaataagtaaatgaactgtaggtgggaagtacaaataatcaagaaggctagga    c.*2760

         .         .         .         .         .         .    g.64615
tgaactatgtggtactggattcgattcagagacatcggtatgtactcaagtttaacttaa    c.*2820

         .         .         .         .         .         .    g.64675
tattgatagaggtgaatagatacaaaaataattacatgtgcgtatatacatgagtcagta    c.*2880

         .         .         .         .         .         .    g.64735
tacatatgtatagttcctagccctgtgtcctgagagggcctagaagcaatagtaccctag    c.*2940

         .         .         .         .         .         .    g.64795
tagcaacaagcacacccaatgctaagaccttggattctaatatcattctccaataaaagg    c.*3000

         .         .         .         .         .         .    g.64855
aactagagctacttggagaaataactgattctaggaccaaggcaggggaaatacaagatg    c.*3060

         .         .         .         .         .         .    g.64915
ggcctggagaatctcatagcaccagaaagtaaggaattgaggaaaaaaaaaaaaaaaaga    c.*3120

         .         .         .         .         .         .    g.64975
tgaagtcatggcaaaggaatagaggagtcatcctgaaagattgccaaatttggaaaaatt    c.*3180

         .         .         .         .         .         .    g.65035
gcctcaataaaatatagatactcctcaccttctgatggggctatgacttaataaacccat    c.*3240

         .         .         .         .         .         .    g.65095
cataagttagaaatattgtaagttgaaaaggcatttagtaccccaacaaacccatcataa    c.*3300

         .         .         .         .         .         .    g.65155
agtcaaaaaatcataagtcaaaccataagtccagatgctcctcagcttaccacgcaatta    c.*3360

         .         .         .         .         .         .    g.65215
catcccaataaacccaccataaacttgaaaatttgtaagtcaaatggtcataagttgagg    c.*3420

         .         .         .         .         .         .    g.65275
tttgtctgtaatgcagtattagattataacacaaagtataaaatagaggagtccatatgg    c.*3480

         .         .         .         .         .         .    g.65335
acacaaatgacttaattaataattaattaattaatggaggaaaagaggcaaatctcccat    c.*3540

         .         .         .         .         .         .    g.65395
tacagaggaatttatttatccaatcctctgttgatggatacttaggttgatttcatgtct    c.*3600

         .         .         .         .         .         .    g.65455
ttgctattgtagatagtactatgatgaatatacaagtgcagtatctgtttgctaaaatga    c.*3660

         .         .         .                                  g.65488
ttaattttcctttgggtagatacccagtaatgg                               c.*3693


Powered by LOVD v.3.0 Build 22
©2004-2020 Leiden University Medical Center