chloride intracellular channel 2 (CLIC2) - 35221 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5367
gtaagttttccagttataataactgcatgtagaatatattagtttttgacactgaagtcc  c.57+60

         .         .         .         .         .         .  g.5427
aatgtctttaaaaattctccacatttgggctagagataggaaagaatgttgtgattattt  c.57+120

         .         .         .         .         .         .  g.5487
tcctactctgagttctagaagaatgcccgggtgtgtgactgttcttagatgacaacagga  c.57+180

         .         .         .         .         .         .  g.5547
aaacagatctcttctgaaaaaggcaaggtgatatggtggaaaagcactagactggtttgt  c.57+240

         .         .         .         .         .         .  g.5607
agtgagcgactaaattatattcttaatggcttcctatataaccttagaaaaatccctcct  c.57+300

         .         .         .         .         .         .  g.5667
tctctccagacttttttttctccatctatacaatgaaggagcatgacaagatgatcctta  c.57+360

         .         .         .         .         .         .  g.5727
agggctttccaagtctcaaaatctgtgttttatgagataggttttggaaggcctgactgg  c.57+420

         .         .         .         .         .         .  g.5787
gtggaggagagggccgagaatgacctgagaactccattcccacacatagcctagacagaa  c.57+480

         .         .         .         .         .         .  g.5847
ctttctaaacttctacaatggacaaacatcacagcagggtcacatggacactgggagaaa  c.57+540

         .         .         .         .         .         .  g.5907
aaaaacaggagtctgtgtgcttgttatgtgaggagggggacattttagaatgctctgctt  c.57+600

         .         .         .         .         .         .  g.5967
cttctttttggtctgccatggagttgtttttttttttttttaacatgtcaacttttcaga  c.57+660

         .         .         .         .         .         .  g.6027
aaagcactttggaaaacccctaaatcaagagaaaggaacatgtgtttccaaattagctca  c.57+720

         .         .         .         .         .         .  g.6087
tcaagaaagaaaaatttatatgggttattcccagtagaaattaaacagcttactaaatcc  c.57+780

         .         .         .         .         .         .  g.6147
tcgcttacattaactgtgtagcttttccctttattttcactgactattggatagtattca  c.57+840

         .         .         .         .         .         .  g.6207
ggataataagaacaataacaaactcatattgtgcctggctcttttctaaatactttacat  c.57+900

         .         .         .         .         .         .  g.6267
atgttacctaatttagtcctaacaacttaggagataggttgttattaatggtgcttgtat  c.57+960

         .         .         .         .         .         .  g.6327
agtactagcatcatcagtagtagtagtgatagtagtagttattactacttcattacaact  c.57+1020

         .         .         .         .         .         .  g.6387
tttagttattacaatattataatgttgttctcatcatttctagataggtaaactaaggca  c.57+1080

         .         .         .         .         .         .  g.6447
ttaaagtttaagtaacttgcctctaaaactatacagctccctgatggcttacaaagacat  c.57+1140

         .         .         .         .         .         .  g.6507
aaaataagatatacttaccaaatgttaagttaaatacctattggcaaaagtaatgctttt  c.57+1200

         .         .         .         .         .         .  g.6567
acagccagttagattatttaacagcttgtcacatatatacaccaaggacatcatcaacct  c.57+1260

         .         .         .         .         .         .  g.6627
gtcttttcaaaattgtaagagaaagacccttgaattcctgcagtgctaggtaatgcaatt  c.57+1320

         .         .         .         .         .         .  g.6687
aagtgtttgctaaactatcgggcataagagcgacttcttctatctctgggttgtagcaaa  c.57+1380

         .         .         .         .         .         .  g.6747
acatataactgctcagataggatataaatgagctgtaatttcctaactggctttttacat  c.57+1440

         .         .         .         .         .         .  g.6807
ttaccaattccaaatcagaagtaatgtctcttcactgggtaactaaagtgttccctttgt  c.57+1500

         .         .         .         .         .         .  g.6867
ctgaactgttcattcaactcaattagactcctgaaatcaattgttggctttcacctatgt  c.57+1560

         .         .         .         .         .         .  g.6927
gtttatcttcatagacttttcatatttgggtggtaatctggacaggaaactttagcaagt  c.57+1620

         .         .         .         .         .         .  g.6987
cacacatggatgagaaaatgttgaattaaataataactttcaaaggaaccaataatttat  c.57+1680

         .         .         .         .         .         .  g.7047
tgagtacttactatatggtaggcactgtgctaagtggtttattaaccctcttttatgaat  c.57+1740

         .         .         .         .         .         .  g.7107
acagaaattaaagcaaagagcagctaagtaactttgtccaaggtcacatagctagttagt  c.57+1800

         .         .         .         .         .         .  g.7167
ggcagagttagaattctattcctttaaaatagctatgtctaatattattcaattgttttc  c.57+1860

         .         .         .         .         .         .  g.7227
agttgtgtgaactttttagtaaactagtccagaattttatcaggtggagtgctttagatg  c.57+1920

         .         .         .         .         .         .  g.7287
taagcttatctaatgacattgatacaaattacagattttctggaagaacctcaaatatca  c.57+1980

         .         .         .         .         .         .  g.7347
tctggtccaggtttttgttttattttaagctgtgttccacagatctctagaagtttcgtg  c.57+2040

         .         .         .         .         .         .  g.7407
gaagatactgggaggggaaataggggttgagaaagactaaaagtgctaatgagtaatttt  c.57+2100

         .         .         .         .         .         .  g.7467
taaaaggcattactacaagagattaagcattctcctgtcacaattaagaatttatactac  c.57+2160

         .         .         .         .         .         .  g.7527
gatatctatgtgttctgtgtagtcaataaaaacattgtcttttagctctgaatgatttga  c.57+2220

         .         .         .         .         .         .  g.7587
gcaaggtttctatccaataactaagaacaaagatttcataacacacattttattttctct  c.57+2280

         .         .         .         .         .         .  g.7647
aagtgtagggatgaaataatcttaatgatttgttgtttgttgttaaatggaatgtttgca  c.57+2340

         .         .         .         .         .         .  g.7707
ttctgtaccaaagactctaaaattaagttttagtatatttgtacataaaattatggaatt  c.57+2400

         .         .         .         .         .         .  g.7767
taacatttgggccaaaattctgaatgtaatacttttgtcaaaaactttttttaatgtgtg  c.57+2460

         .         .         .         .         .         .  g.7827
ggggaaagaaggaagagatgatactctactctgagtgttcagaccatttcaaagtatctt  c.57+2520

         .         .         .         .         .         .  g.7887
atagctattataaatacttataaagactgattaatataaaaattcaacaaaactattaaa  c.57+2580

         .         .         .         .         .         .  g.7947
tgagagaaggcagtgtttaagagtatggtgtctggaggatatagtcctggtcctgaattt  c.57+2640

         .         .         .         .         .         .  g.8007
actgagtgagaagaggatgtatgtcatcaactcttgattagccgactgtacttgagcaag  c.57+2700

         .         .         .         .         .         .  g.8067
tcagcctctctgagcctcagtttcctcacctgtaaaacaagtgtaataacagagcctacc  c.57+2760

         .         .         .         .         .         .  g.8127
tcatagcatcatcctatttgtaaggattaaataaaacaagtgtataaagcacagtagttg  c.57+2820

         .         .         .         .         .         .  g.8187
gcaatgtagtaaacactttataaatgttaactattgttgccattattatttttcatgttt  c.57+2880

         .         .         .         .         .         .  g.8247
aaaaacttagatcacaaacacaaagaaaaaaattgttttggtgaatggctgcatcctgtc  c.57+2940

         .         .         .         .         .         .  g.8307
tttgccagctgaagataattaagagatcagtaattcatcaatcaggctagcgaatttata  c.57+3000

         .         .         .         .         .         .  g.8367
tcctaaaattgtatgtgatggcactttaaatcagcataacataacagaaaaaaaaaccct  c.57+3060

         .         .         .         .         .         .  g.8427
tcagttttcctgtaaaactttactgcatttcccccacacctcagtgttttgattttcctt  c.57+3120

         .         .         .         .         .         .  g.8487
ttgccaaaggcgatccacccttcctgctgtatctattatcagactccattcttcttcctg  c.57+3180

         .         .         .         .         .         .  g.8547
cctcccacccttaatcatgtttccactcactaaacctagttttgattggatccttagtct  c.57+3240

         .         .         .         .         .         .  g.8607
gacttctattacaaaacaaatgcagctggtaaggttggttgcctcttcccattcctcttc  c.57+3300

         .         .         .         .         .         .  g.8667
acaccctgccatcataaagatcaacaatatcattttctttgtcacatccactatcaggga  c.57+3360

         .         .         .         .         .         .  g.8727
aagaaaattttgtcaaaaaattgaaattttgtccagtgtttctggaccttaataattcta  c.57+3420

         .         .         .         .         .         .  g.8787
cgcataatagatcagagcagccgtaagatgaagtaccttttatttccttctataggctac  c.57+3480

         .         .         .         .         .         .  g.8847
tctctctagtctttcctatcataattcttggtgattttaatatctacacagatgattctt  c.57+3540

         .         .         .         .         .         .  g.8907
ccaacactctagcccctcagatccctgactttccctcctccagggatcttagtcctcatc  c.57+3600

         .         .         .         .         .         .  g.8967
atctctcaggtgcttcttcccatagtcatacgcttacctttgtcattgcaatgtctgcaa  c.57+3660

         .         .         .         .         .         .  g.9027
cctctgcataatatcatttatttgggggtgttttttgttcttctttttgaacttctctat  c.57+3720

         .         .         .         .         .         .  g.9087
tttcataggtacatgtttaactttgacaaaatactttaaaaagcagttgtaccattttac  c.57+3780

         .         .         .         .         .         .  g.9147
acttcacttcattatgtgagagttccacttgctccactttcctgtcaacacttggtatgg  c.57+3840

         .         .         .         .         .         .  g.9207
tcattctttttcatttcagttattctaatgtgtttatcatggtatctcattgtggtttta  c.57+3900

         .         .         .         .         .         .  g.9267
atttgcctttcccacatgtctaatgatattgggcatcttttcatgtccttatttatcatc  c.57+3960

         .         .         .         .         .         .  g.9327
tgtatatcttcctttgtaaagttttcaaatctcttccccattttaattgttctttaactt  c.57+4020

         .         .         .         .         .         .  g.9387
taatttttaatttttgtgagtacatagtaggtatatatatttatgggttgcatggaatat  c.57+4080

         .         .         .         .         .         .  g.9447
tttgatacaggcatgcaacatgtaataatcacatcaggtaaatgggatattcatcccctc  c.57+4140

         .         .         .         .         .         .  g.9507
aagcatttatcttttgggttacaaacaattcaattatactgttttagttatttttaaatg  c.57+4200

         .         .         .         .         .         .  g.9567
tacaattaaattatttttcactgcagtcaccttattgtgctagcaaatactaggtgttat  c.57+4260

         .         .         .         .         .         .  g.9627
tcatccttcctagctattttttgtacccattaacactcttcacctccccacacacacaga  c.57+4320

         .         .         .         .         .         .  g.9687
ctcactacccttcccagcctctagtagccatcctttactctctctatgagttcaaatgtt  c.57+4380

         .         .         .         .         .         .  g.9747
tttgttcttagctctcacaaataagtgagaacacgtgaagtttgtctttctgtgcctggc  c.57+4440

         .         .         .         .         .         .  g.9807
ttattttatgtaatatatgacgtccagttccatccatgttgttgcaaatgactgaatctc  c.57+4500

         .         .         .         .         .         .  g.9867
attcttttttatggttgaatagtactctgctgtgtatatgcccacattttctgtatccat  c.57+4560

         .         .         .         .         .         .  g.9927
tcatctgttgatgggatatttaggttgcttccaaatcttggctattgtgaatagtactgc  c.57+4620

         .         .         .         .         .         .  g.9987
aatgaatgtgggagtgcagagatctctgtgatatgctgatttcctttctttggggtagat  c.57+4680

         .         .         .         .         .         .  g.10047
acctagcagtgggattgctggaccataaggtagctctattttcatttttttgaggaacct  c.57+4740

         .         .         .         .         .         .  g.10107
ccaaactgttctccatagtggttgtactaatatttacattcccatcaacagtgtttgagg  c.57+4800

         .         .         .         .         .         .  g.10167
attcccttttctctatatcctcgccagcgtttgttatttcctgtcttttggataaaagcc  c.57+4860

         .         .         .         .         .         .  g.10227
attttattaggttggtgcaaaagtaattgcggtttttgcaattgaaagtaatggcaaaac  c.57+4920

         .         .         .         .         .         .  g.10287
cgcatttacttttgcaccaacctaataactgagctgagatgatatctcattgtagttttg  c.57+4980

         .         .         .         .         .         .  g.10347
atttgaatttctctgatgatcaatgacattgagcaccttttcatatggctcttcaccatt  c.57+5040

         .         .         .         .         .         .  g.10407
tgtatatcttcttttgaggaatgtctattcacatcttttgcccatttgtcaaacacagta  c.57+5100

         .         .         .         .         .         .  g.10467
ttagattttttcctatagagttatttgagctccttatatattctggttattaatcccttg  c.57+5160

         .         .         .         .         .         .  g.10527
tcagataggtggtttgcaaatactttctcccattctgtgggtcgtctttgcacattgttg  c.57+5220

         .         .         .         .         .         .  g.10587
attcctttgctgtgcagaagcttgttaacttgatgtgatcccattcgtccatttttgctt  c.57+5280

         .         .         .         .         .         .  g.10647
tgcttgcctgtatttatggcatattattcaagaaatctctgcccactccaatgtcttgga  c.57+5340

         .         .         .         .         .         .  g.10707
gagtttccctaatgttttcttttagtagtttcatagtttcaggtcttagatttaagcctt  c.57+5400

         .         .         .         .         .         .  g.10767
taatccatttgtatttgattttttgtatatggtgagagataggggtctagtttcattctt  c.57+5460

         .         .         .         .         .         .  g.10827
ttgcatatggatatccagttttcccagcacctttccccagtgtatgatcttggcaccttt  c.57+5520

         .         .         .         .         .         .  g.10887
cctgaaaatgagttcattgtaaatgtatagacttatctccaggttctctattcttttcca  c.57+5580

         .         .         .         .         .         .  g.10947
ctgatctatgtgtctttttttatgccaggaccatgccattttggttactatagctctgta  c.57+5640

         .         .         .         .         .         .  g.11007
gtataatttgaagtcaggtattgcttaggagatagctttggctattctgggtctttcctg  c.57+5700

         .         .         .         .         .         .  g.11067
gttccatataaatattaggatttttaaaaatttctgtgaatatatgtctttgtcattttg  c.57+5760

         .         .         .         .         .         .  g.11127
atagggattgcattaaatctatagattgctttgggtactatggacattttaactatattt  c.57+5820

         .         .         .         .         .         .  g.11187
attcttccaattcataaatatagaatatctttccatttttgtatgtctttttcaatttct  c.57+5880

         .         .         .         .         .         .  g.11247
tgtatcaatgttttatagttttcaggtagaaatcttttagtatttttgttaattactatg  c.57+5940

         .         .         .         .         .         .  g.11307
tactttatttcatttgtagctattgcaaatggaattactttcttgattttttttcacatt  c.57+6000

         .         .         .         .         .         .  g.11367
gttcactgttggcatatagaaatgtcactgatttttgtacgttgattttgtaacctgcaa  c.57+6060

         .         .         .         .         .         .  g.11427
ctttactgaatttatcaactttaagagttttcattggagtgtttaggtttttccaaatat  c.57+6120

         .         .         .         .         .         .  g.11487
aagatcatatcatctgcaaacaaggtaatttgacttcctcctttccaatttggaagcctt  c.57+6180

         .         .         .         .         .         .  g.11547
tttatttctttatcttgtctgattgctctggctaggacttccagtactatgttgaataac  c.57+6240

         .         .         .         .         .         .  g.11607
tgtggtgaaagtgggcatccttgttatgttcccaatcttagaggacaggatttcagtttt  c.57+6300

         .         .         .         .         .         .  g.11667
tgtccattcagtataatactagctatgggtttgtcatatatggcttttattctgttgagg  c.57+6360

         .         .         .         .         .         .  g.11727
tatgttccctctatacccatgtttttgagggttttttgtcataaagggatgtttaatatt  c.57+6420

         .         .         .         .         .         .  g.11787
atcaaatgctttttcagcaacaattaaaatgatcatgaggtttttgttcttcattctgtt  c.57+6480

         .         .         .         .         .         .  g.11847
gatatgatgtatctcattaattgatgtgtgtatgttgaatcattcttgcatcactggaat  c.57+6540

         .         .         .         .         .         .  g.11907
aaattgcacttggtcatgataaatgatcttttgttttgtttttgttttcacttttaagta  c.57+6600

         .         .         .         .         .         .  g.11967
caggggtacatgtgcagatttgttatataggtaaacttgtgtcatgggtgtttgttgtac  c.57+6660

         .         .         .         .         .         .  g.12027
aaattatttcatcacccaggtattaagcctagtacccattagctatttttttttctgagt  c.57+6720

         .         .         .         .         .         .  g.12087
ccatgtattctcatcttttagctgccacttgtaagtgagaatgtgtggtatttggttttc  c.57+6780

         .         .         .         .         .         .  g.12147
tgttgctgcattaatttgctagggataatggcttctagctctgttcatgttcctataaag  c.57+6840

         .         .         .         .         .         .  g.12207
gacatgatctcattcttttttaaaaaagtgactttattttattttagttacataaattac  c.57+6900

         .         .         .         .         .         .  g.12267
aaaatatcactaagtgaaaataaaatcaataaaaatcatccatgataccacccactttaa  c.57+6960

         .         .         .         .         .         .  g.12327
catttatgtgtatagcctcttatgctttatttcctcacatatatagataaatacattcat  c.57+7020

         .         .         .         .         .         .  g.12387
caaaaagaggttatttcatatattaagttggtacaaaattaattgcgctttttgccatta  c.57+7080

         .         .         .         .         .         .  g.12447
cttttaatacattgttttgcaaactatttttatttcacaatatattatgaatttatttct  c.57+7140

         .         .         .         .         .         .  g.12507
ataacattaaatatattatctgtatgtatgtgtgtcttggtttcttatgactaaaatttt  c.57+7200

         .         .         .         .         .         .  g.12567
ttaaaattaaggcgttgttatgttgagatagttgaagattcacatgcagttttaagaaat  c.57+7260

         .         .         .         .         .         .  g.12627
aatacagagagatgctgtgtgccctttaccaagtttcccttaatgataacatcttgtaaa  c.57+7320

         .         .         .         .         .         .  g.12687
actatagtatgataagaaaaccaggacattattgacattgatgcagtcagatacagaaga  c.57+7380

         .         .         .         .         .         .  g.12747
ttttcatcactacacagatccgtgttgcccttttaaagccacatccacttgtgtctcatc  c.57+7440

         .         .         .         .         .         .  g.12807
cagtccctcaaccattaatctcttttctgctttgataattttatcatgtcaagaatgtta  c.57+7500

         .         .         .         .         .         .  g.12867
cgtaaatggaataaaacagtatatcaccttttgggattgtcttttttttccccactcagc  c.57+7560

         .         .         .         .         .         .  g.12927
acaattccctggaacttcatccaagttgttgtgtgtatcaacagtttgatcctttttatt  c.57+7620

         .         .         .         .         .         .  g.12987
gctgagtactactccatgatactgatatgccacagtttgtttaattattcagctgttgaa  c.57+7680

         .         .         .         .         .         .  g.13047
ggacattttggttgtcactagttttgggttattacaaacaaggctgtataaatcctcttt  c.57+7740

         .         .         .         .         .         .  g.13107
tacaggtttctttatggacataagttttcatttctctgagataaatgccaaagggtctag  c.57+7800

         .         .         .         .         .         .  g.13167
ttgtttggtcgcgtagcagctgcatgtttagatttggaagaaattgccaaagtgctttcc  c.57+7860

         .         .         .         .         .         .  g.13227
agtgtggtcatactattttacattaaaaccagcaatatttctgtgcattcttaccagcat  c.57+7920

         .         .         .         .         .         .  g.13287
tttgtgttgtcactattattatcttaactattttgaaagctgtgtagtgacattttattg  c.57+7980

         .         .         .         .         .         .  g.13347
tttaaatttgcatttcccaaaaggctaataaaattgaacattttgtctgcttatttgtca  c.57+8040

         .         .         .         .         .         .  g.13407
tctgcatgtcctcttcagtgcaatgtctgtccatgtcctttgctaattttcttttttcct  c.57+8100

         .         .         .         .         .         .  g.13467
tttttattttagagtatttagttggcaaataaagattgtatatattcaatgtatacaaca  c.57+8160

         .         .         .         .         .         .  g.13527
caatgattttgtttctttttaaaaagaattatttatttttcaatgggtttttggggaaca  c.57+8220

         .         .         .         .         .         .  g.13587
ggtgaagtttggttacatgaataagatatatagtagtgatttcagagatattggtgcatc  c.57+8280

         .         .         .         .         .         .  g.13647
cgtcacccaagcagtgtacactgtacccaatgtgtagtcttttatcttcactcccccacc  c.57+8340

         .         .         .         .         .         .  g.13707
cctttctctgagtcttcaaagtccattgtatcattcttatgcctttgcgtcctcatagct  c.57+8400

         .         .         .         .         .         .  g.13767
tagctcccaattataagtgagaacataccatgtttggctttccattcctgagttacttca  c.57+8460

         .         .         .         .         .         .  g.13827
cttagaataatagtctccaattccttccaggttgctgcaaatgccattatttagtgcctt  c.57+8520

         .         .         .         .         .         .  g.13887
tttatggctgagtagtattccatggtgtgtgtatgtgtgcatatatatatatatatatat  c.57+8580

         .         .         .         .         .         .  g.13947
atatatatatatatatatatatcacattttcttttttattatactttcagttcttggatg  c.57+8640

         .         .         .         .         .         .  g.14007
catgtgcagaacgtgcaggtttgttacataggtatacatgtgccatggtggtttgctgca  c.57+8700

         .         .         .         .         .         .  g.14067
cccatcaacccgtcatctaggttttgggctccacatgcattaggtaatgctctccctctc  c.57+8760

         .         .         .         .         .         .  g.14127
atttccccccactccgcaactggctccagtgttccatgtgttctcattgttcagctccca  c.57+8820

         .         .         .         .         .         .  g.14187
cttatgagtgagaacatgtggtgtttgcttttctgttcctgtgttagtttgctgagaatg  c.57+8880

         .         .         .         .         .         .  g.14247
atgggttccatctttatccatgtctctgcaaaggacatgaactcattctcttttatggct  c.57+8940

         .         .         .         .         .         .  g.14307
gcataatattccatggtgtatctgtgccacattttctttgtccactctatcattgatggc  c.57+9000

         .         .         .         .         .         .  g.14367
cctttgggttgattccaagtctttgctcttgtaaatagtgctgcagtaaacatatgtgtg  c.57+9060

         .         .         .         .         .         .  g.14427
catgtgcctttatggtagaatgatttataatcctttgggtatatacccagtaatgggatt  c.57+9120

         .         .         .         .         .         .  g.14487
gctgggtcaaatggtatttctgattctagatccttgaggaattttcacactgtcttccac  c.57+9180

         .         .         .         .         .         .  g.14547
aatgattgaactaattgacattcctactaacagtgtaaaagtgttcctatttctccacat  c.57+9240

         .         .         .         .         .         .  g.14607
cctctccagcatctgttgtttcctgactttttaatgattgccattttaactgatgtgaga  c.57+9300

         .         .         .         .         .         .  g.14667
tggtatctcattgcggttttgatttgcatttctctaatgatcagtgatgattagctttta  c.57+9360

         .         .         .         .         .         .  g.14727
ttcatatgattgttggccacataaatgtcttcttttgagacgctcatatccttcacccac  c.57+9420

         .         .         .         .         .         .  g.14787
tttttgatggggttgtttggttttttcttgtaaatttatttaagttccttgtagattctg  c.57+9480

         .         .         .         .         .         .  g.14847
gatattagccccttgtcagatggatagattgcaaaaattttctccattctgtaggttgcc  c.57+9540

         .         .         .         .         .         .  g.14907
tgatcactctgatgacagtttcttttgccatgcagaagctctttagtttaattagatccc  c.57+9600

         .         .         .         .         .         .  g.14967
atttgtcaattttggcttttgttgccattgcttttgttgttttagtcatgaagtctttgc  c.57+9660

         .         .         .         .         .         .  g.15027
ccatgcctatgtcctgaatggtattgcctaggtttttttctagggtttttatggttttag  c.57+9720

         .         .         .         .         .         .  g.15087
gtcttatgtttaagtttttaatccatcttgagttaatttttgtataaggtgtaaggaagg  c.57+9780

         .         .         .         .         .         .  g.15147
ggtccagattccgttttctgcatatggctagccagttttcccagcaccatttattaaata  c.57+9840

         .         .         .         .         .         .  g.15207
gggaatctttccccatttcttgtttttgtcaggtttgtcaaagatcagatggttgtagat  c.57+9900

         .         .         .         .         .         .  g.15267
gtgtggtgttatatctgaggtctctgttatgttccattggtctatatatgtgttttggta  c.57+9960

         .         .         .         .         .         .  g.15327
ctagtaccatgctgttttggttactgtagccttgtagtatagtttgaagtcaggtagcat  c.57+10020

         .         .         .         .         .         .  g.15387
gatgtctccagctttggttttttgtttgtttgtttgtttttgttttttgtttttgctttg  c.57+10080

         .         .         .         .         .         .  g.15447
gattgttttggctatacaggctctttattggttccatatgaaatttaaagtaggttttta  c.57+10140

         .         .         .         .         .         .  g.15507
aaaattattattatactttaagttttagggtacatgtgcacaacgtgcaggtttgttaca  c.57+10200

         .         .         .         .         .         .  g.15567
tattccaattctgtgaagaaaggcaattgtagcttgatgggaatagcattgaatctataa  c.57+10260

         .         .         .         .         .         .  g.15627
attactttgggcagcatggccattttcatgatattgattattcctatccatgagcatgga  c.57+10320

         .         .         .         .         .         .  g.15687
atgtttttccatttgttgtgtcctctcttatttccttgagcagtggtttgtagttctcct  c.57+10380

         .         .         .         .         .         .  g.15747
caaagaggtccttcacatcccttgtaagttgtatttctaggtattttattctctttgtag  c.57+10440

         .         .         .         .         .         .  g.15807
caattgtgaatgggagttcactcatgatttggctctctattttggttgtataggaatgct  c.57+10500

         .         .         .         .         .         .  g.15867
tgtgatttttgcacattgattttgtgtcctgagactttgctgaagttgcttatcagctta  c.57+10560

         .         .         .         .         .         .  g.15927
aggagtttttgggctgagacaatggggttttctaaatatgcaatcatgtcatctgcaaac  c.57+10620

         .         .         .         .         .         .  g.15987
agatacaatttgacttcctctcttcctatttgtatatgctttatttctttctcttgcctg  c.57+10680

         .         .         .         .         .         .  g.16047
attgccctggccagaacttccaatgctatgttgaataggagtggtgagagagggcatcct  c.57+10740

         .         .         .         .         .         .  g.16107
tgtcttgtgccagttttcaaagggaatatttccagcttttgcccattcagtatgatattg  c.57+10800

         .         .         .         .         .         .  g.16167
gctatgggtttttcatggatagctcttattattttcagatacattccatcaataactagt  c.57+10860

         .         .         .         .         .         .  g.16227
tgattgagagtttttagcatgaaggtatattgaattttatcgaaggctttttatgcatct  c.57+10920

         .         .         .         .         .         .  g.16287
attgagacaataatgtggtttttgtcattggttctctttacatgctgtataatgtttatt  c.57+10980

         .         .         .         .         .         .  g.16347
gatttgcatatgttgaaccagccttgtatcccagggatgaagccaacttgatcatggtga  c.57+11040

         .         .         .         .         .         .  g.16407
ataagctttttgatgtgctgctggattcagtttgccagtattttattgaggattttcaca  c.57+11100

         .         .         .         .         .         .  g.16467
acaatgtttatcagggatattggcgtgaaattttctttttgtgtgtgtgtctctgacagg  c.57+11160

         .         .         .         .         .         .  g.16527
ttctggtgtcaggatgaaattggcatcataaaatgagttagggaggagtccctctttttc  c.57+11220

         .         .         .         .         .         .  g.16587
tattgtttggaatagtttcagaaggaatggtaccagctcctctttgtacctctggtagaa  c.57+11280

         .         .         .         .         .         .  g.16647
tttggctgtgaatccgtctgatcctgtgcttttttggttggtaaactgttaattgctgcc  c.57+11340

         .         .         .         .         .         .  g.16707
tcaatttcagaacttgttattgttctattcagggattgacttcttcctgtgtccaggaat  c.57+11400

         .         .         .         .         .         .  g.16767
ttatgcatttcttttagtttttctagtttatttgtgtagaggtgtttgcagtattatctg  c.57+11460

         .         .         .         .         .         .  g.16827
atggtagtttgtatttctgtgggatgagtggtgatatcccctttatcattttttattgtg  c.57+11520

         .         .         .         .         .         .  g.16887
tctatttgattcctctcagttttcttctttattagtctggctagcagtcaatctattttg  c.57+11580

         .         .         .         .         .         .  g.16947
ttcatcttttcaaagaaccagctcctggatttattgatttttttgaaggatttttcgtgt  c.57+11640

         .         .         .         .         .         .  g.17007
ctctatctccttcacttgtgctctgatcttagttgcttcttgtcttctgctagcttttga  c.57+11700

         .         .         .         .         .         .  g.17067
atttgtttgctcttgcttctctagttcttttaattgtgatgttaggctgttgattttaaa  c.57+11760

         .         .         .         .         .         .  g.17127
tctttcccgctttctgatgtgggattttagtgctataaatttccctctaaacactgcttt  c.57+11820

         .         .         .         .         .         .  g.17187
agttatgtcccagagattccggtacattgtgtctttgttctcattagtttcaaagaactt  c.57+11880

         .         .         .         .         .         .  g.17247
tatttctgccttaatgtcgttgtttacccagtagtcattcaggagcagttgttcagtttc  c.57+11940

         .         .         .         .         .         .  g.17307
catgtagttgtgcggttttgagtgagtttcttaatcctgagttctaatttgattgcactg  c.57+12000

         .         .         .         .         .         .  g.17367
tggtctgagagactgtttgtcatgatttccattcttttgcatttgctgaggagtgtttta  c.57+12060

         .         .         .         .         .         .  g.17427
cttccaattatgtggtcaattttagaataagtgtgatgtggtgctgagaggaatgtatat  c.57+12120

         .         .         .         .         .         .  g.17487
tctgttgatttggggtggagagttctgtagatgtctattcggtctgcttggtccggagct  c.57+12180

         .         .         .         .         .         .  g.17547
gagttcaagtcctgaatatccttgttaattttctgtctcgttgatctaatgttgacagtg  c.57+12240

         .         .         .         .         .         .  g.17607
gggtgttaaagtctcccactattattgtgtgggagtctaagtctctttgtaggtctctaa  c.57+12300

         .         .         .         .         .         .  g.17667
gaacttgctttatgaatctggttgctcctgtattgggtgcatatatatttaggatagtta  c.57+12360

         .         .         .         .         .         .  g.17727
gctcttcttgttgcattgattccttgaccattatgtaatacccttctttgtcttttttga  c.57+12420

         .         .         .         .         .         .  g.17787
tctttgttggtttaaattttgctttatcaggaactaggattgcaacccctgctttttttt  c.57+12480

         .         .         .         .         .         .  g.17847
tctttccatttgcttggtaaatattcctccatccctttattttgagcctatgtgtgtctt  c.57+12540

         .         .         .         .         .         .  g.17907
tgcacatgagatgggtctcctgaatacagcacactgatgggtcttgactctttatccaat  c.57+12600

         .         .         .         .         .         .  g.17967
ttgccggtctgtgtgttttaattggaacatttagcccatttatattcaaggttaatattg  c.57+12660

         .         .         .         .         .         .  g.18027
ttatgtgtgaatttgatcctgtcattatgatgctagttattttgctcattagttgttgca  c.57+12720

         .         .         .         .         .         .  g.18087
gtttcttcacagtgtcgatggtctttacaatttggtatgtttttgcagttgctggtaccg  c.57+12780

         .         .         .         .         .         .  g.18147
gttttttctttccatgtttagtgcttctttctggagctcttgaaaggcaggcctggtggt  c.57+12840

         .         .         .         .         .         .  g.18207
gacaaaatctctcagcatttgcttgtctgtaaaggattttatttttccttcgcttatgaa  c.57+12900

         .         .         .         .         .         .  g.18267
gctttgcttgtctggatatgaaattcttggttgaaaattctgtttttaatgaatgttgaa  c.57+12960

         .         .         .         .         .         .  g.18327
tattggcccccactctcttctggcttgtaggctttctgcagagagatctgctattagtct  c.57+13020

         .         .         .         .         .         .  g.18387
gatgggcttccctttgtgggtaacccgacctttctctctggctgcccttaacattttttc  c.57+13080

         .         .         .         .         .         .  g.18447
cttcatttcaaccttggtgaatctgatgattatgtgtcttggggttgctcttctcgagga  c.57+13140

         .         .         .         .         .         .  g.18507
gtatctttgtggtgttctctgtatttccagaatttgaatgttggcctgccttgctaggtt  c.57+13200

         .         .         .         .         .         .  g.18567
ggggaagttctcctggataatatcctgaagagtgttttccaacttggttccattctccct  c.57+13260

         .         .         .         .         .         .  g.18627
gtcactttcaggtacaccagtcaaacgtaggtttggtcttttcacatagtcctatatttc  c.57+13320

         .         .         .         .         .         .  g.18687
ttggaggctttgtttgtttcttttcattcttttttctctaatcttgtcttcatggtttat  c.57+13380

         .         .         .         .         .         .  g.18747
ttcattaagttgatcttcaacctctgatatcctttcttccacttgattgatttggctatt  c.57+13440

         .         .         .         .         .         .  g.18807
gatacttgtgtatgcttcacgaagttcttgtgctgtgtttttctgctccattaggtcact  c.57+13500

         .         .         .         .         .         .  g.18867
tatgttcttctctatactggtttttctagttagcaatttgcctaaccttttttcaaggtt  c.57+13560

         .         .         .         .         .         .  g.18927
cttagcttctttgcattgggttagaacatgctcctttatcttggacgagtttgttattac  c.57+13620

         .         .         .         .         .         .  g.18987
ccactttctgaagcctacttctgtcagtttgtcaaactcgttctccatccagtttatttc  c.57+13680

         .         .         .         .         .         .  g.19047
ccttgctagcgaggagttgtgatactttggaggagaagaggcattctggtttttggaatt  c.57+13740

         .         .         .         .         .         .  g.19107
ttcagacgttttgcactggtttttcctcatatttgtggatttgtctacttttggtctttt  c.57+13800

         .         .         .         .         .         .  g.19167
atgttggtgaccttcggatggtgaccttctgtgtggacatcctttttgttgatgttgatg  c.57+13860

         .         .         .         .         .         .  g.19227
ctattcctttctgtatcttagttttgcttctaacagtcaggaccctctgctgcaggtctg  c.57+13920

         .         .         .         .         .         .  g.19287
ctggagttggctggaggtccactcccgacctatttgcctgggtatcaccagcagaggctg  c.57+13980

         .         .         .         .         .         .  g.19347
cagaacagcaaagattgccttctgttccttcctctggaagctttgtcccagaggggcacc  c.57+14040

         .         .         .         .         .         .  g.19407
tgccagatgccagctggagctctcttgtatgaggggtctgtcgacccctgcagggaggag  c.57+14100

         .         .         .         .         .         .  g.19467
tctcccagtcaggaggcacgggggtcagggacccacttgaggaggcagtctgtcccttag  c.57+14160

         .         .         .         .         .         .  g.19527
cagagcttgagcaccatgctgggagatccactgctctctttagcaccagtaggcaggaac  c.57+14220

         .         .         .         .         .         .  g.19587
gtctaagtctgctgaagctgcacccacagccaccccttccccctggtgttctgtcgcagg  c.57+14280

         .         .         .         .         .         .  g.19647
gagatgggagttttatctataagccctgactggggctgctgcctttctttcagagatgcc  c.57+14340

         .         .         .         .         .         .  g.19707
ctgcccagagggaggaatctagagaggcagtctggctacagcggctttgccgagctgcag  c.57+14400

         .         .         .         .         .         .  g.19767
tgggctctgcccatttccagctttctggtggctttgtttacactgtgaggggaaaagagc  c.57+14460

         .         .         .         .         .         .  g.19827
ttactcaagcctcagtaatggtggacaccccttcccctaccaatctgaagcatcccaggt  c.57+14520

         .         .         .         .         .         .  g.19887
cgacttcagactgctgtgctggcagtgagaatttcaagccagtggatcttagcttgctgg  c.57+14580

         .         .         .         .         .         .  g.19947
gctccatgggatgggatccactgagctagaccacttggctccctagcttcagcccccttt  c.57+14640

         .         .         .         .         .         .  g.20007
ccaggggagtgaatggttctgtctcactggtgttctaggcaccactggggtatgaaaaaa  c.57+14700

         .         .         .         .         .         .  g.20067
aaaactcctgcagctagcttggtgtctgcccaaatggccgcccagttttgtgcttgaaac  c.57+14760

         .         .         .         .         .         .  g.20127
ccagggccctggtggagtaggcactggagggaatctcctggtctgctggttgcgaagact  c.57+14820

         .         .         .         .         .         .  g.20187
gtgggaaaagcatagtatctgggccagagtgcaccattcctcacggcacagtccttcaag  c.57+14880

         .         .         .         .         .         .  g.20247
gcttcccttggttaggggagggagttccccgaccccttgtgcttcctgagtgaggtgacg  c.57+14940

         .         .         .         .         .         .  g.20307
ccccaccctgctttggctcaccctccttgggctacacccactgtctaaccagtcccaatg  c.57+15000

         .         .         .         .         .         .  g.20367
agatgagctgggtacctcagttggaaatgcagaaatcacctgccttctgtgttgatctcg  c.57+15060

         .         .         .         .         .         .  g.20427
ctgggagctgcagaccaaagctgttcttatttggccatcttgccagcccccagttatttc  c.57+15120

         .         .         .         .         .         .  g.20487
ttttgctatacagaagctttttcatttaattaattcccatctatttagctttgtttgtat  c.57+15180

         .         .         .         .         .         .  g.20547
tgcatttgcttttgggttcttggtcatgaagtctttgcctaaaccaatgtctagaagaga  c.57+15240

         .         .         .         .         .         .  g.20607
ttttccaatgttttcttctagaatttttatggtttcaggtcttagatttaagtctttgat  c.57+15300

         .         .         .         .         .         .  g.20667
tcatcttgaattatttctgtataaggtgagagatgaggatccagtttcattcttctacat  c.57+15360

         .         .         .         .         .         .  g.20727
gtggcttgccaattatcccgacattatttgttgaatagggtgtcctttccccactttatg  c.57+15420

         .         .         .         .         .         .  g.20787
tttttgtttgctttgttgaagatcagttggctataagtatttggctatatttctgggttc  c.57+15480

         .         .         .         .         .         .  g.20847
tgtattcagttccattggtctatgtgtccatttttataccagtaccatgctgttttggtg  c.57+15540

         .         .         .         .         .         .  g.20907
actatagccttatagtctagtttgaagtcgggtaatgagatgcctccagatttgttcttt  c.57+15600

         .         .         .         .         .         .  g.20967
ttgcttagtctttcttttgctatgtgggcttttttggtttcatatgaattttagaattgt  c.57+15660

         .         .         .         .         .         .  g.21027
ttttctagttccgtgaagaatgacagtggtattttcatgggaattgcattgaatttgtag  c.57+15720

         .         .         .         .         .         .  g.21087
attgcttttggcagtatggtcattttcacaatattgattctacccatccatgagcatggg  c.57+15780

         .         .         .         .         .         .  g.21147
atgtatttccatttgtttgtgtcatctatgatttctttcagcagtgttttgtagttttct  c.57+15840

         .         .         .         .         .         .  g.21207
ttgtagaggtctttcacctccatggttaggtatattcctgagttgttcattttattttat  c.57+15900

         .         .         .         .         .         .  g.21267
tttttgcaactatggtaaaagggattgagttcttattttattctcagcttggtcactatt  c.57+15960

         .         .         .         .         .         .  g.21327
ggtatataggagagctactgttttgtgtacattaattttgtatcctgaaactttgctgaa  c.57+16020

         .         .         .         .         .         .  g.21387
tttatttaccagttctaggagctttttggatgagtctttagagttttctaggtatacaaa  c.57+16080

         .         .         .         .         .         .  g.21447
catatcatcagcaaacaggaacagtttgacttcctctttaccaatttggatgcccttgat  c.57+16140

         .         .         .         .         .         .  g.21507
ttttttctcttttctgattgctctggctgggacttccagtactatcttgaatataagtgg  c.57+16200

         .         .         .         .         .         .  g.21567
taaaagtgagcatcattgtcttgttccagttctcagggggaatgctttcatcttttccct  c.57+16260

         .         .         .         .         .         .  g.21627
gttcagtataacgttggctatgggttcgtcatagatggcctttattaccttaaggtatgt  c.57+16320

         .         .         .         .         .         .  g.21687
ttcttctctgccaattttgctgaaggttttaatcataaagagatgctggattttgtcgaa  c.57+16380

         .         .         .         .         .         .  g.21747
tgctttttatgtatctattgagatgatcatgtgatttttgtttttaattatttctatgtg  c.57+16440

         .         .         .         .         .         .  g.21807
gtgtatgacatttgttaacttgcagatgttaaaccatccctgcatccctggtatgaaact  c.57+16500

         .         .         .         .         .         .  g.21867
cacttgatcatggtggattatctttttgatatgctgttggatttaattagctagcatttt  c.57+16560

         .         .         .         .         .         .  g.21927
gttaaagatttttgcatatatgttcatcatgaatattggtctgtagttttctttttttat  c.57+16620

         .         .         .         .         .         .  g.21987
gtccttccttggttttggtattagggggatactggcctcctggaatgatttagagataat  c.57+16680

         .         .         .         .         .         .  g.22047
ttcctttttatccaatggaatagtgtcaataggattggtaccaattcttctttgaatgcc  c.57+16740

         .         .         .         .         .         .  g.22107
agatagaatgcagctgtaaatctgtctggtcctggacttttgttgttgttgttggcaatt  c.57+16800

         .         .         .         .         .         .  g.22167
tttaaattatcattttaatcttgctgcttgttattggtgtgttcagagttactataactt  c.57+16860

         .         .         .         .         .         .  g.22227
cctggtttaatctagaagatctttgtatttccaggaatttatcctcttctctaggctttc  c.57+16920

         .         .         .         .         .         .  g.22287
tagtttatgcatgtaaagatgttcacagaagccttaaataatttttttgtatttctgtcg  c.57+16980

         .         .         .         .         .         .  g.22347
tatcagtagtaatatctctcatttcatttctaattgagtttatttggatcttctctcttc  c.57+17040

         .         .         .         .         .         .  g.22407
ttggttaatctcactaactgtctatcaattttatttatcttttccaataacaagcttttg  c.57+17100

         .         .         .         .         .         .  g.22467
tttcacttatcttttgtgtcttgtttgtttgtttcaatttcacttagttctgctctgatc  c.57+17160

         .         .         .         .         .         .  g.22527
tttatttcttttcttctgctgggtttgggtttggattgcttttgtttcttcagttctgtg  c.57+17220

         .         .         .         .         .         .  g.22587
aggtgtgacctcagattgtgtatttgtgctctttcagactttttgatgtaggcatttaat  c.57+17280

         .         .         .         .         .         .  g.22647
actatgagctttccttttagcaccactctgatggttaatactgagtgtcaacttgattgg  c.57+17340

         .         .         .         .         .         .  g.22707
attgaaggatgcaaagtattgatcctgggtgtgtctgtgagggtgttcccaaaggagatt  c.57+17400

         .         .         .         .         .         .  g.22767
aacatttgagtcagtgggctgggaaaggcacacccacccttaatctgattgggcagcatc  c.57+17460

         .         .         .         .         .         .  g.22827
ttattagctgccagcatggctagaatataaagtaggcagaaaaatataaaaagatgagac  c.57+17520

         .         .         .         .         .         .  g.22887
tgacttagcctcccagcctacatctttctctcgtgctggatacttcctaccctcaaacat  c.57+17580

         .         .         .   g.22918
tggactccatgttcttcagttttgggacttg  c.57+17611

--------------------- middle of intron ---------------------
                  g.22919     .         .         .           g.22948
                  c.58-17610  gcctggttctccttgctcctcagcttacag  c.58-17581

.         .         .         .         .         .           g.23008
acagcctattgtgggaccttgtgatcatgttagttaatacttaataaactaataggatat  c.58-17521

.         .         .         .         .         .           g.23068
atataatatatatcctgttagttctgtccctctagagaaccctgacaaatacagccactt  c.58-17461

.         .         .         .         .         .           g.23128
ttgctgtatcccagaggttttgataagttgtgtcactgttatcgttcagttcaaacaatt  c.58-17401

.         .         .         .         .         .           g.23188
tttgatttccatcttcatttcattttgacccaacaatcattcaggaggttatttaatttt  c.58-17341

.         .         .         .         .         .           g.23248
caggtatttgtgtggttttgaggattccttatggagtttatttctaattttattccactg  c.58-17281

.         .         .         .         .         .           g.23308
tgttctgagagaatacttgatataattttgattttcttaaatttactgagacttgttttg  c.58-17221

.         .         .         .         .         .           g.23368
tgccttatcatgtggtctatcttggagaatgttccatgtgttgataaatagaatgtatat  c.58-17161

.         .         .         .         .         .           g.23428
tctgcagttgttgggaagaatgttctgtaaatatctgttaagtccatttgttttagggta  c.58-17101

.         .         .         .         .         .           g.23488
tagtttaagttgatggtttatttgttgactttcttttttgatgacctgtctagtgctgtc  c.58-17041

.         .         .         .         .         .           g.23548
agtagagtcttaaagtcccccactattattgtgttaccatctatctcatttcttaggtct  c.58-16981

.         .         .         .         .         .           g.23608
agtagtaattgttctataaattcaggagctctggtgttaggtgcatatatatttaggatt  c.58-16921

.         .         .         .         .         .           g.23668
gtgatattttcctgttggactagtccttttatcattctttaatgtctctgtttgtctttt  c.58-16861

.         .         .         .         .         .           g.23728
ttaactgctattgctttaaagtttgttttgtctgatataagaatagctacttctgctcac  c.58-16801

.         .         .         .         .         .           g.23788
ttttggtgtccatttgcatggaatatctttttcctttaccttaagtttacctgagtcctt  c.58-16741

.         .         .         .         .         .           g.23848
atgtgttaggtgagtctcctgaagacagcagaaacttgtttggtgaattcttatccattg  c.58-16681

.         .         .         .         .         .           g.23908
tagaatggattctatatcttttaagtgaggcatttaggccatttacattcaatgttagta  c.58-16621

.         .         .         .         .         .           g.23968
ctgagatgtgaggtactattctattcatcatgctatttgttgcctcaataccttggtttt  c.58-16561

.         .         .         .         .         .           g.24028
tttttcattgtgttattgttatatagatcctgtgagatttgtgctttaagtaggttccat  c.58-16501

.         .         .         .         .         .           g.24088
tttggtgtatttcaaggatttgtttcaaaatttagagctccttttagcagttcttgtatt  c.58-16441

.         .         .         .         .         .           g.24148
gccagcttggtagtggcgaattctcccagcatttgtttgtctgtaaaagactgtatcttt  c.58-16381

.         .         .         .         .         .           g.24208
tcttcatttatgaagcttagtttcactggatacaaaattcttgggtgataattgttttgt  c.58-16321

.         .         .         .         .         .           g.24268
ttaaggaggctaaaaataggaccccaattccttttagcttgtagggtttctgctgagaaa  c.58-16261

.         .         .         .         .         .           g.24328
cctgctgttactctgataggttttcctttataggttacctgatgctttttcctcatagct  c.58-16201

.         .         .         .         .         .           g.24388
cttaagattattttgtttgtcttgattttagataacctgatgactatgtgcctaggcaat  c.58-16141

.         .         .         .         .         .           g.24448
tatctttttgtgataaattttccaggtgttctttgagcttattttatttggatgcctaga  c.58-16081

.         .         .         .         .         .           g.24508
tatctaaaggctggagaagttttccttgattattccctcaaatatggttttcagactttt  c.58-16021

.         .         .         .         .         .           g.24568
agatttctcctcttccttgggaacatcaattagtcttaggtttgggtgtttaacatagtt  c.58-15961

.         .         .         .         .         .           g.24628
ccaagctttttggaggctttgttcactttttttgttttttaattatttttttctttgtct  c.58-15901

.         .         .         .         .         .           g.24688
ttgagggattcagttaatttgaaagccttatcttcaagctctgaagttctttctcctgct  c.58-15841

.         .         .         .         .         .           g.24748
tgtttgattctactgctgagactttccagtgcattttgcatttctataagtgtgtcctta  c.58-15781

.         .         .         .         .         .           g.24808
atttccagaagttgtggttgttttttatttatgctatctatttcattgaagatttttgct  c.58-15721

.         .         .         .         .         .           g.24868
ttcatatcattgaagatttttcctttcatatcctgtatcatgtttatgatttctttaagt  c.58-15661

.         .         .         .         .         .           g.24928
tggagttcacctttctctgatgtctccttgattagcttaataatctaccttctgaattct  c.58-15601

.         .         .         .         .         .           g.24988
ttttctggcaattcaggtattttatcttggtttggatccattgcttgtgagctggtgtga  c.58-15541

.         .         .         .         .         .           g.25048
tcttttgggagtgttaaattaccttgttttgttgtattaccagaattgattttctagtta  c.58-15481

.         .         .         .         .         .           g.25108
tttctcacttgcttagactatgtcagagggaagatctgggaggggctgttcaaattcttt  c.58-15421

.         .         .         .         .         .           g.25168
tctcccacggggtggtcccttgattgttgttctcacacttcctctagaattcgggcttcc  c.58-15361

.         .         .         .         .         .           g.25228
tgagagccgaactgcggtgattgtttttgctcttctaggtctagccacctagcggagcta  c.58-15301

.         .         .         .         .         .           g.25288
ctggcttcaggctggtactggagagtatctgcaaagagtcctgtgatatgacccatcttc  c.58-15241

.         .         .         .         .         .           g.25348
atgtcttttggccatggataccagcacctgctctggtagagatagcaggggagtgaagtg  c.58-15181

.         .         .         .         .         .           g.25408
gattctgtgagagtctttggttgtatttttatttaatgtgctggatttgtattggttggc  c.58-15121

.         .         .         .         .         .           g.25468
ctccagccaggaggtggtgctttcaagagcacatcagttgtagtagtctagggaggaagc  c.58-15061

.         .         .         .         .         .           g.25528
aaactttccctagggtcacctggttaagtattcaggtttctcgggtggtgggcagagcca  c.58-15001

.         .         .         .         .         .           g.25588
tagagctcccaagagattatgtcccttgtccttgcaaccagggtgggtagagaaagacca  c.58-14941

.         .         .         .         .         .           g.25648
ccaagtgggggcagggttaggcatgtctgagctcagactctccttgagtgtagcttgctg  c.58-14881

.         .         .         .         .         .           g.25708
tggctgctgtaggggatgggggtgtggttcccaggccaatggagttatgttcccacgggg  c.58-14821

.         .         .         .         .         .           g.25768
ataatagctgcctctgctgagtcatacagatcaccaaggaagtaggggaaagctggcagt  c.58-14761

.         .         .         .         .         .           g.25828
cacaggctcatcccgcacccatgcagcctgcagtcctaaaggccagtcttactcccactg  c.58-14701

.         .         .         .         .         .           g.25888
tgccccctcaacagcaccgagtctatttctgggaatctggtgatcaaggctgagaacttg  c.58-14641

.         .         .         .         .         .           g.25948
ccccagaccaccagcctcccagctaaaaagcaaggagactcacagtttttcagcatctca  c.58-14581

.         .         .         .         .         .           g.26008
gggagcatgcagcagtgctccagttccttcaaagggtctgtggattatctcagcttccct  c.58-14521

.         .         .         .         .         .           g.26068
ggaatgttgctgtggtacttcttggagcaaaagatcatgatgtgagcctccacacctctc  c.58-14461

.         .         .         .         .         .           g.26128
tgtctgtccaagtgggagctgcaagctagtgctgcctcctatctgccatcttaattatct  c.58-14401

.         .         .         .         .         .           g.26188
tattcttttttatggctgcatcatattcagttgtgtatatgtaccacattgtctttatcc  c.58-14341

.         .         .         .         .         .           g.26248
agtctaccattgatgggcatttaggttgattccatgtttttgctattgtgaatagtgctg  c.58-14281

.         .         .         .         .         .           g.26308
cagtgagcatgtgtgcatgcatctttatgataaaataatttatatctctttgggtagata  c.58-14221

.         .         .         .         .         .           g.26368
cccagtaataggattgctgggtaaaatggtagttctatttttaggtctttaagaaaatgt  c.58-14161

.         .         .         .         .         .           g.26428
cacactgctttccacaatagttgaactaatttagactcccacttaacagtgtctgtgttc  c.58-14101

.         .         .         .         .         .           g.26488
ctttttccctgcaactttgacagtagttttgttttttttttttttttttgccttatttat  c.58-14041

.         .         .         .         .         .           g.26548
atagagaggtggcattttgctatgtatcctgggctggtctagaactcctgggctcaagtg  c.58-13981

.         .         .         .         .         .           g.26608
atccatcctccctccgtggcatcccaaagtgctaggattgcaggcatgagccatggtgcc  c.58-13921

.         .         .         .         .         .           g.26668
cagcctatttttgactttttaatcatagccattctgactgcgtgagatggtgtctcattc  c.58-13861

.         .         .         .         .         .           g.26728
tggttttgatttgaatttctctaattatcaggggtgttgaacttttttttcatacgctca  c.58-13801

.         .         .         .         .         .           g.26788
ttggccacatgcatgtcttcttttgaaaagtgtctattcatgttatttgcccactttttc  c.58-13741

.         .         .         .         .         .           g.26848
ataggctttttcttgtaaatttgtttaagtttcttatagatgctggatattaggccttca  c.58-13681

.         .         .         .         .         .           g.26908
tcagatgcatatggaaaaacattccatgttcatggataggaaaaataaatatcattaaaa  c.58-13621

.         .         .         .         .         .           g.26968
tggccatactgcccaaagcaatctatagattcaatgctattcctatcaaactaccaatga  c.58-13561

.         .         .         .         .         .           g.27028
cattcttcacagaaccagaaaagactattttaaaattcatatggaatcacaaaaagagcc  c.58-13501

.         .         .         .         .         .           g.27088
caaatagtcaaagcaatcctaagcaaaaagaacaaagctggaggaatcaccttacctcac  c.58-13441

.         .         .         .         .         .           g.27148
tcaaaactatactacagagctatggttaccaaaacagcatggtactggcacagaaacaga  c.58-13381

.         .         .         .         .         .           g.27208
cacatagaacaatggaacagaatagagagcccaaaaataaggccacacacctacaacaat  c.58-13321

.         .         .         .         .         .           g.27268
ctgatctttgacaagcctgacaaaaacaagcattggggaaaagactccttattcaataaa  c.58-13261

.         .         .         .         .         .           g.27328
tggtgctgggataattggctagccctatgcaggaggtttaaaatggacccctttcctaca  c.58-13201

.         .         .         .         .         .           g.27388
ccatatacaaaaataaactcaagatgggtgaagtactgaaatgcaaaatgcaaaagtgca  c.58-13141

.         .         .         .         .         .           g.27448
aaaaccctggaagaaaacctaggcaataccattctggacataggaacaggcaaagatttc  c.58-13081

.         .         .         .         .         .           g.27508
atgatgaagacaccaaaaacaactgcaacaaaaggaaaaattgacaaatggggtctaatt  c.58-13021

.         .         .         .         .         .           g.27568
aaacttaagagctcctacacagcaaaagaaactatcaacacagtaaacagacaacctaca  c.58-12961

.         .         .         .         .         .           g.27628
gaatgaatgatcattttaatatgttgttgaattcagtttgctagtattttattgacaatt  c.58-12901

.         .         .         .         .         .           g.27688
tttgcaacaataatcatatggtttggctgtgtccccacccaaatttcatcttgaattgta  c.58-12841

.         .         .         .         .         .           g.27748
gctcccataattccctcatgttgtgggagggacccagtgggagataattgaatcatgggc  c.58-12781

.         .         .         .         .         .           g.27808
acagtttcccccatactgttctcatggtagtgaataagtctcacaagatctgatagtttt  c.58-12721

.         .         .         .         .         .           g.27868
ataaggggaaaccgctttcccttggctctcattctcttctcttgtctgctgccatgtgag  c.58-12661

.         .         .         .         .         .           g.27928
atgtgcctttcaccttctgccatgattttgaggcctccccagccacaaggaactatgagt  c.58-12601

.         .         .         .         .         .           g.27988
ccattaaacctctttcttttgtaaattgcccagtgtcgggtatgtctttatcagcagcat  c.58-12541

.         .         .         .         .         .           g.28048
gaaaatggactaatacagtaaattggtaccaagaatagggtgctacttaaaagatactca  c.58-12481

.         .         .         .         .         .           g.28108
aaaatgtggaagcaactttggaactgggtaataggcagaggttggaacacatgggagggc  c.58-12421

.         .         .         .         .         .           g.28168
tcagaagaagacagaaaaatgtgggaaagctaggaacttcctagagacttgttgaatggc  c.58-12361

.         .         .         .         .         .           g.28228
tttgaccaaaatgctgatgatatggacaataaaatacaggctgaggtggtctcagatgga  c.58-12301

.         .         .         .         .         .           g.28288
gatgaggaacttgctgggaaccggagcaaaggtgacacttgttatgttttagcaaagaga  c.58-12241

.         .         .         .         .         .           g.28348
ctggcagcattttgtccctgccctagagatttgtggaagtttgaacttgagagagatgat  c.58-12181

.         .         .         .         .         .           g.28408
ttagggtatctggcagaagaaatttctaagcagcaaagcattcaagaggtgacttgggta  c.58-12121

.         .         .         .         .         .           g.28468
ctgttaaaagcattcacttttaaaaaggaaacacagcataaaatttcagaaaatttgcag  c.58-12061

.         .         .         .         .         .           g.28528
cctgacagtgtgatagaaaagaaaatcccattttctgaggagaaattcaagccagctaca  c.58-12001

.         .         .         .         .         .           g.28588
gaaatttgcataagtaacaaggagcagaatgttaatcaccaagacaatggggaaaatgtc  c.58-11941

.         .         .         .         .         .           g.28648
tccagggcatgtcagagacttttgtggcagccccttccaccacaggccctgagacctaag  c.58-11881

.         .         .         .         .         .           g.28708
aatgaaaaatgattctgtgggctgggcgcagggtccctctgctgtttgcagtctagggac  c.58-11821

.         .         .         .         .         .           g.28768
ttggtgccctgcatcccagccactccaggcatgactagaagcggccaaagtatagctcag  c.58-11761

.         .         .         .         .         .           g.28828
gctgtggctacagagcatgcaagccccaagctttggcagcttccatgtggtgttgagcct  c.58-11701

.         .         .         .         .         .           g.28888
gcagtgcacagaagtcaagaattgaggtttgggaacctgtgcctagatttcagagaatgt  c.58-11641

.         .         .         .         .         .           g.28948
atggaaatacctggatgtccaggcagagtttgcttcggggtggggccctcatggagaacc  c.58-11581

.         .         .         .         .         .           g.29008
tctgctggggcagtatggaagggaaatgtggggttggagcccccacacagagtccccatg  c.58-11521

.         .         .         .         .         .           g.29068
gggtgctgcctagtgtagctgtgagaagagggccaccatcctccagaccccagaatggta  c.58-11461

.         .         .         .         .         .           g.29128
gatccactgacagtttgcaccatgtgcctggaaaagccacagacactcaatgccagcctg  c.58-11401

.         .         .         .         .         .           g.29188
tgaaaacaaccaggagagaggctgtaccctgcaaagccacaggggcagagctgcccaagg  c.58-11341

.         .         .         .         .         .           g.29248
aaacaaggtgagaaaaatgcaaatgcaagtgtcaggatggaccaagtggccagggcatag  c.58-11281

.         .         .         .         .         .           g.29308
ccaatccattcagtgatctcactggggaaattggcttcagaaacatacataaacaagcca  c.58-11221

.         .         .         .         .         .           g.29368
ccttgtggattcctataggttatttctccaggcttcctgacctggcactatatacagtca  c.58-11161

.         .         .         .         .         .           g.29428
ctataaatgttgatttccattcccaaaataaacaagaagacacctaagctaaaccttata  c.58-11101

.         .         .         .         .         .           g.29488
aacccaagacaatgggaacccatctctcaagcatcagcatgacccagatgcaagacatga  c.58-11041

.         .         .         .         .         .           g.29548
agtctaaggagatcattttggagttttaagatctgactgccctgctggattccagacttg  c.58-10981

.         .         .         .         .         .           g.29608
catagggcctgtatcccctttgttttggccaatttctcccatttggaatgactgtgttta  c.58-10921

.         .         .         .         .         .           g.29668
cccaatgtctgtacccctccattgtatctaggaaataactaacttgcttttgattttact  c.58-10861

.         .         .         .         .         .           g.29728
ggttcatagatggaagggacttgcattgtctcagatgagactttggattgtggacttttg  c.58-10801

.         .         .         .         .         .           g.29788
agtaaatgctaaaatgagttaagactttgagggactgttgggaaggcataattggttttg  c.58-10741

.         .         .         .         .         .           g.29848
aaatgtgaagacatgagatttgggaggggccaggggcagaatgatatggtttggctgtgc  c.58-10681

.         .         .         .         .         .           g.29908
ccccacccaaatttcatcttgaattgtaacacccataattccctcatgttgtgggaggga  c.58-10621

.         .         .         .         .         .           g.29968
cccagtgggagataattgaatcatggggacagtttcccccatactgttctcatggtagta  c.58-10561

.         .         .         .         .         .           g.30028
agtctcatgagatctgatggctttataagggcccctttcacttggctctcattctcttct  c.58-10501

.         .         .         .         .         .           g.30088
cttgtctgctgccatgtgagatgtgcctttcaccttcttccatgattgtgaggccttccc  c.58-10441

.         .         .         .         .         .           g.30148
agccacgtggaactgtgagtccattaaacctctttttatttttattttttttgtaaattg  c.58-10381

.         .         .         .         .         .           g.30208
ctcagtctcatgtatgtctttatcagcagcatggaaacagactaatacaaatatttatca  c.58-10321

.         .         .         .         .         .           g.30268
gtgatattggcctatagttttcttttttgatgtgtctttggttttggtatcatggtaata  c.58-10261

.         .         .         .         .         .           g.30328
ctggccttgtagaatgatattagaagtattttctccacctataattttcagaatagtttg  c.58-10201

.         .         .         .         .         .           g.30388
agtagaattggtgtgagttatttttatttttttatttttgagacaggggctcactcatgt  c.58-10141

.         .         .         .         .         .           g.30448
tgcccaggctggagtgcagtggcacaatcttagctcccttcaaccttgacttcccaagct  c.58-10081

.         .         .         .         .         .           g.30508
caggtgatcctcctacctcagtctcctgagtagctgggactacaggcacgtgccaccatg  c.58-10021

.         .         .         .         .         .           g.30568
cctggataattgtttatatttttagtagagacagagggttttttttacttgtatcttatt  c.58-9961

.         .         .         .         .         .           g.30628
gtactgtctatgtctcaaaacattgttgtagttattatttttgattggttcatcatttag  c.58-9901

.         .         .         .         .         .           g.30688
tctttctacttaagagtagtttacaaaccacagttacagtattataatattctgtgtttt  c.58-9841

.         .         .         .         .         .           g.30748
tctgtgagttttatgccttctggtgattacttatttgtcattaaccttattttttttctg  c.58-9781

.         .         .         .         .         .           g.30808
attgaagtactccctttagcatttcttgtagggtatatctggtgttgataaaaagccctc  c.58-9721

.         .         .         .         .         .           g.30868
agctttcatttgtctgggaagatttttatttctccatgtttgaaggatgtttttgctgga  c.58-9661

.         .         .         .         .         .           g.30928
tatactattctagggtaaaagtgtttttctttcaacaccttcactgtgtcatgccactct  c.58-9601

.         .         .         .         .         .           g.30988
ctcctgacctgtaagattgccactgaaaagtctgcttccagacgcactgaagtgccattg  c.58-9541

.         .         .         .         .         .           g.31048
tatgttattagtttcttttctcttgctgctttaagatcctttctttatccttgacctttg  c.58-9481

.         .         .         .         .         .           g.31108
agagttggacgttaaatgccctgagatagtcttttttgggttaaatctacttggtgttct  c.58-9421

.         .         .         .         .         .           g.31168
atgacattctcgtacttgcatatcaatgtctttctctaggttttggaagttctctgttga  c.58-9361

.         .         .         .         .         .           g.31228
tatcccttgaataaactttctatcctatctctttctctacctcctctttaaggccaataa  c.58-9301

.         .         .         .         .         .           g.31288
ctcttagatttgcccttttgaagctattttgtagatttcataggcatgctttattctttt  c.58-9241

.         .         .         .         .         .           g.31348
ttatgatttttttcttttttctcgtctgtgtgttttaaaatagcctgccttcaagctcat  c.58-9181

.         .         .         .         .         .           g.31408
taattctttcttctgcttgatcaattctactattaaaagactttgatgcatttttcggta  c.58-9121

.         .         .         .         .         .           g.31468
tgtcagttacatttttcaactccagaatttccactcgattcttttaagttatttcaatct  c.58-9061

.         .         .         .         .         .           g.31528
ctttgttaggtttacctgatagaattctctgtgttatctcaatttttttttagtttcctc  c.58-9001

.         .         .         .         .         .           g.31588
aaaacagttattttgaatctttgtctgaaatgtcacgtatctctgttgctccaggattgg  c.58-8941

.         .         .         .         .         .           g.31648
tccctagtgccttatttagttcatttggtgaggtcatgttttcctggatggtcttgattc  c.58-8881

.         .         .         .         .         .           g.31708
ttatggatgtttatctacatctgggcattaaagagttaggtatttattgtaatcttcaca  c.58-8821

.         .         .         .         .         .           g.31768
gtctgggcctgtttgtacccatcgttcttgggaaggctttaatttggctttcctgctcca  c.58-8761

.         .         .         .         .         .           g.31828
cctctcctctcttttgcccaatttattttaagacagagtctcactctgttgcccatgctg  c.58-8701

.         .         .         .         .         .           g.31888
gagtagagtggcatgatcttggctcactgcaacctctgcctccagggttcaagcaattct  c.58-8641

.         .         .         .         .         .           g.31948
cctgcctcagcctgccaagtagctgggattacaggagcccaccaccatgcccagctaatt  c.58-8581

.         .         .         .         .         .           g.32008
tttagtagagatggggtttcatcatgttgctcaggctggtctcgaacccctgacctcaag  c.58-8521

.         .         .         .         .         .           g.32068
tgatctgcctgcctcagcctcccaaagtgctaggattacaggcatgagccaccacacttg  c.58-8461

.         .         .         .         .         .           g.32128
gcgtctcttgcccatttttaaagttgggtagttagttgttgagttgtgttctttatttgt  c.58-8401

.         .         .         .         .         .           g.32188
atttttatatgttatagatacaggacttttttattttcttaataattcttttgaaaagca  c.58-8341

.         .         .         .         .         .           g.32248
ggacattttatttttgctctatcccagcttattgaatttttctcttctctccctcctctg  c.58-8281

.         .         .         .         .         .           g.32308
aattccagtcacattgaccttctttcagttctttatacatgccatgctcaagcctattgc  c.58-8221

.         .         .         .         .         .           g.32368
aagacctttgcacatgttattccctgtttagaatgccctcttcgtgcccattcatctaat  c.58-8161

.         .         .         .         .         .           g.32428
taactgttacttatcctttgaacttagtttaaatgctacttcctcagggaaggccttccc  c.58-8101

.         .         .         .         .         .           g.32488
tgacagaccccatatagatttctcagagtttctctgttatacactcataaaatgcacttc  c.58-8041

.         .         .         .         .         .           g.32548
ctttcttcaaataatttatctctgtttaaaactgagagttaatttgggggaatattttta  c.58-7981

.         .         .         .         .         .           g.32608
ttttaatatctggtgtgtatatatatatgtatatgtctggtatatgttacacacataatt  c.58-7921

.         .         .         .         .         .           g.32668
tgttcagtgaatattcattgggtaagtaaatgagtaagtgaagaaagagggtccaccaat  c.58-7861

.         .         .         .         .         .           g.32728
aaactcaagtgcatataaaatttcaaagcagaaaaagtgttttccatcagtagaaaaaat  c.58-7801

.         .         .         .         .         .           g.32788
gatggctgatatagtttagatatttctccttgcccaaatctcatgttaaattttaattcc  c.58-7741

.         .         .         .         .         .           g.32848
caattctggaggtggggcatggtggaaagtgtttggatcatgagggcaaacctctcatgg  c.58-7681

.         .         .         .         .         .           g.32908
cttagtgctgccctcatgatagtgagtgagttctcatgagatctggttgttgtaaagtgt  c.58-7621

.         .         .         .         .         .           g.32968
ggcatctcatcccccactctctctctctctctctcactcctgctttcgccatgtgaagtg  c.58-7561

.         .         .         .         .         .           g.33028
tctgctcccagttcaatttctgctatgagtaaaatttccctgaggcctccccagaagctg  c.58-7501

.         .         .         .         .         .           g.33088
agcagatgctggtgccatgtttgtacagccagcagaactgtgagccaattaaacctcttt  c.58-7441

.         .         .         .         .         .           g.33148
tcttataaattatccagtctcaagtatttctttagagtaatgcaagagtgacctaataca  c.58-7381

.         .         .         .         .         .           g.33208
atgatgtatcaggctgtgtttgcaatactataaaaaaaatctgagcctgggtaaattata  c.58-7321

.         .         .         .         .         .           g.33268
aagaaaaaaagtttaattgactcatagttctgcagatattacaagaagcatggtgctggc  c.58-7261

.         .         .         .         .         .           g.33328
atctgattctggtgagggccttaggaagcttacaatcatggtggaaagtgaagagggagc  c.58-7201

.         .         .         .         .         .           g.33388
aggtgtctccatgctgaaagtgggaacaagagagcaaggggggaggtgccacatactttt  c.58-7141

.         .         .         .         .         .           g.33448
aacaaccagatctcgagggaactaactgagcaggaacaaacttattaacaagatgatggt  c.58-7081

.         .         .         .         .         .           g.33508
gctaaaccattaatgagggatccgcccccaggatccaatcacctcctaccaggccccacc  c.58-7021

.         .         .         .         .         .           g.33568
tccaacattggagattacatttcaacatgagatttggaggggacaaatatccaaaccata  c.58-6961

.         .         .         .         .         .           g.33628
tcagatggatttatttaatgaaaggcataagactattaactatttgtaaaaatttaaaaa  c.58-6901

.         .         .         .         .         .           g.33688
tactaaagaagtcctcatacacttcttacaccaaaacaaaatccaaataaatgaaacaaa  c.58-6841

.         .         .         .         .         .           g.33748
tgcaaaaattaaaccatgatggtactagaagaaaacgtgatagaaaatccttatggtaaa  c.58-6781

.         .         .         .         .         .           g.33808
tcaaaatataaaaataaagtaaggaaatatgttttttgtaatcttgatgtatataagcag  c.58-6721

.         .         .         .         .         .           g.33868
atcagaaaagccagaccacgtagagaaaaagcatggtagatctcatgtaaatttaaattt  c.58-6661

.         .         .         .         .         .           g.33928
tacataatccatgtttttaaaattacatgtaacatatatcacaaagagttaatgtcttta  c.58-6601

.         .         .         .         .         .           g.33988
aaatacaaataatttttccaaacaataagaaaaagtcattaccttcataaaaaaattaaa  c.58-6541

.         .         .         .         .         .           g.34048
aactgtcataaacaaacaattcacaaaataaggaaatggccaatggccatatggaaaggc  c.58-6481

.         .         .         .         .         .           g.34108
acctttcagaaaggaaatttggtggagggaggagccaagatggccgaataggaacagctc  c.58-6421

.         .         .         .         .         .           g.34168
cggtctacagctcccaggatgagcgacgcagaagacgggtgatttctgcatttccatctg  c.58-6361

.         .         .         .         .         .           g.34228
aggtaccgggttcatctcactagggagtgccagacagtgggcgcaggtcagtgggtgcgt  c.58-6301

.         .         .         .         .         .           g.34288
gcaccgtgcgcgagccgaagcagggcgaggcattgcctcacttgggaagagcaaggggtc  c.58-6241

.         .         .         .         .         .           g.34348
agggagttccctttctgagtcaaagaaaggggtgacagatggcacctggaaaatcggatc  c.58-6181

.         .         .         .         .         .           g.34408
actcccacccgaatactgcgcttttccggcgggcttaaaaaacggcgcaccacatatccc  c.58-6121

.         .         .         .         .         .           g.34468
gcacctggctcggagggtcccacgcccacggagtctcgctgattgctagcacagcagtct  c.58-6061

.         .         .         .         .         .           g.34528
gagatcaaactgcaaggtggcagcgaggctgggggaggggcgcccgccattgcccaggct  c.58-6001

.         .         .         .         .         .           g.34588
tgattaggtaaacaaagcagcccagaagctcgaactgggtggagcccaccacagctcaaa  c.58-5941

.         .         .         .         .         .           g.34648
gaggtctgcctgcctctgtaggctccacctctgggggcagggcatagacaaacaaaaaga  c.58-5881

.         .         .         .         .         .           g.34708
cagcagtaacctctgccgacttaaatgtccctgtctgacagctttgaagagagcagtggt  c.58-5821

.         .         .         .         .         .           g.34768
tctcccagcacgcagctggagatctgagaacgggcagactgcctcctcaagtgggtccct  c.58-5761

.         .         .         .         .         .           g.34828
gacccctgacccccgagcagcctaactgggaggcaccccccagcaggggcacactgacac  c.58-5701

.         .         .         .         .         .           g.34888
ctcacatggcagggtactcaaacagacctgcagctgagggtcctctctgttagaaggaaa  c.58-5641

.         .         .         .         .         .           g.34948
actaacaaacagaaaggacatccccaccaaaaacccatctgtacatcaccatcatcaaag  c.58-5581

.         .         .         .         .         .           g.35008
accaaagtagataaaaccacaaagatggggaaaaaacagaacagaaaaactggaaactct  c.58-5521

.         .         .         .         .         .           g.35068
aaaaagcagagcgcctctcctcctccaaaggaacgcagttcctcaccagcaacagaacaa  c.58-5461

.         .         .         .         .         .           g.35128
agctggatggagaatgactttgacgagctgagagaagaaggcttcagatgatcaaattac  c.58-5401

.         .         .         .         .         .           g.35188
tctgagctacgggaggacattcaaaccaaaggcaaagaagttgaaaactttgaaaaaaat  c.58-5341

.         .         .         .         .         .           g.35248
ttagaagaatgtataactagaataaccaatacagagaagtgcttaaaggagctgatggag  c.58-5281

.         .         .         .         .         .           g.35308
ctgaaaaccaaggctcgagaactacgtgaagaatgcagaaggctcaggagccgaagcgat  c.58-5221

.         .         .         .         .         .           g.35368
gaactggaagaaagggtatcagcaatggaagatgaaatgaatgaaatgaagcgagaaggg  c.58-5161

.         .         .         .         .         .           g.35428
aagtttacagaaaaaagaataaaaagaaatgagcaaagcctccaagaaatatgggactat  c.58-5101

.         .         .         .         .         .           g.35488
gtgaaaagaccaaatctacgtctgattggtgtacctgaaagtgacggggagaatggaacc  c.58-5041

.         .         .         .         .         .           g.35548
aagttggaaaacactctgcgggatattatccaggagaacttccccaatatagcaaggcag  c.58-4981

.         .         .         .         .         .           g.35608
gccaacgttcagattcaggaaatacagagaacgccacaaagatactcctcgaaaagagca  c.58-4921

.         .         .         .         .         .           g.35668
actccaagacacataattgtcagattcaccaaagttgaaatgaaggaaaaaatgttaagg  c.58-4861

.         .         .         .         .         .           g.35728
gcagccagagagaaaggtcgggttaccctcaaagggaagcccatcagactaacagcggat  c.58-4801

.         .         .         .         .         .           g.35788
ctgtcggcagaaaccctacaagccagaagagagtgggggccaatattcaacattcttaaa  c.58-4741

.         .         .         .         .         .           g.35848
gaaaagaattttcaacccagaatttcatatccagccaaactaagcttcatgagtgaagga  c.58-4681

.         .         .         .         .         .           g.35908
gaaataaaatactttacagacaagcaaatgctgagagattttgtcaccaccaggcctgcc  c.58-4621

.         .         .         .         .         .           g.35968
ttacaagagctcctgaaggaagcactaaacatggaaaggaacaaccggtaccagccgctg  c.58-4561

.         .         .         .         .         .           g.36028
caaaatcatgccaaaatgtaaagaccatcgagactaggaagaaactgcatcaactaacga  c.58-4501

.         .         .         .         .         .           g.36088
gcaaaatcaccagctaacatcataatgacaggatcaaattcacacataacaatattaact  c.58-4441

.         .         .         .         .         .           g.36148
ttaaatgtaaatggactaaatgctccaattaaaagacacagactggcaaattggataaag  c.58-4381

.         .         .         .         .         .           g.36208
agtcaagacccatcagtgtgctgtattcaggaaacacatctcacgtgcagagacacacat  c.58-4321

.         .         .         .         .         .           g.36268
aggctcaaaataaaaggatggaggaagatctaccaagccaatggaaaacaaaaaaaggca  c.58-4261

.         .         .         .         .         .           g.36328
ggggttgcaatcctagtctctgataaaacagactttaaaccaacaaagatcaaaagagac  c.58-4201

.         .         .         .         .         .           g.36388
aaagaaggccattacataatggtaaagggatcaattcaacaagaagagctaaatatccta  c.58-4141

.         .         .         .         .         .           g.36448
aatatatatgcacccaatacaggagcaccaagattcataaagcaagtcctgagtgaccta  c.58-4081

.         .         .         .         .         .           g.36508
caaagagacttagactcccacacattaataatgggagactttaacaccccactgtcaaca  c.58-4021

.         .         .         .         .         .           g.36568
ttagacagatcaacgagacagaaagtcaacaaggatacccaggaattgaactcggctctg  c.58-3961

.         .         .         .         .         .           g.36628
caccaaggggacctaatagacatctacagaactctccaccccaaatcaacagaatataca  c.58-3901

.         .         .         .         .         .           g.36688
tttttttcagcaccacaccacacctattccaaaattgaccacatactgggaagtaaagct  c.58-3841

.         .         .         .         .         .           g.36748
ctcctcagcaaatgcaaaagaacagaaattataacaaactatctctcagaccacagtgca  c.58-3781

.         .         .         .         .         .           g.36808
atcaaactagaactcaggattaagaatctcactcaaaaccgctcaactacatggaaactg  c.58-3721

.         .         .         .         .         .           g.36868
aacaacctgctcctgaatgactactgggtacataacgaaatgaaggcagaaataaagatg  c.58-3661

.         .         .         .         .         .           g.36928
ttctttgaaaccaatgagaacaaagacacaacataccagaatctctgggacacattcaaa  c.58-3601

.         .         .         .         .         .           g.36988
gcagtgtgtagagggaaatttatagcactaaatgcccacaagagaaagcaggaaagatcc  c.58-3541

.         .         .         .         .         .           g.37048
aaaattgacaccctaacatcacaattaaaagaactagaaaagcaagagcaaacacattca  c.58-3481

.         .         .         .         .         .           g.37108
aaagctagcagaaggcaagaaataactaaaatcagagcagaactgaaggaaatagagaca  c.58-3421

.         .         .         .         .         .           g.37168
caaaaaacccttcaaaaaatcaatgaatccaggagctggttttttgaaagggtcaacaaa  c.58-3361

.         .         .         .         .         .           g.37228
attgatagaccgctagcaagactaataaagaaaaaaagagagaagaatcaaatagacgca  c.58-3301

.         .         .         .         .         .           g.37288
ataaaaaatgataaaggggatatcaccactgattccacagaaatacaaactaccatcaga  c.58-3241

.         .         .         .         .         .           g.37348
gaatactacaaacacctctacgcaaataaactagaaaatctagacgaaatggataaattc  c.58-3181

.         .         .         .         .         .           g.37408
ctggacacatacactctcccaagactaaaccaggaagaagttgaatctctgaatagacca  c.58-3121

.         .         .         .         .         .           g.37468
ataacaggagctgaaattgtggaaataatcaatagcttaccaaccaaaaagagtccagga  c.58-3061

.         .         .         .         .         .           g.37528
ccagatggattcacagccgaattctaccagaggtacaaggaggaactggtaccattcctt  c.58-3001

.         .         .         .         .         .           g.37588
ctgaaactcttccaatcaatagaaaaagagggaatcctccctaactcattttatgaggcc  c.58-2941

.         .         .         .         .         .           g.37648
agcatcattctgataccaaagccaggcagagacacaacaaaaaaagagaattttagacca  c.58-2881

.         .         .         .         .         .           g.37708
atatccttgatgaacattgatgcaaaaatcctcagtaaaatactggcaaaacgaatccag  c.58-2821

.         .         .         .         .         .           g.37768
cagcacatcaaaaagcttatccaccatgatcaagtgggcttcatccctgggatgcaaggc  c.58-2761

.         .         .         .         .         .           g.37828
tggttcaatatacacaaatcaataaatgtaatccagcatataaacagagccaaagacaaa  c.58-2701

.         .         .         .         .         .           g.37888
aaccacatgattatctcaatagatgcagaaaaagcctttgacaaaattcaacaacccttc  c.58-2641

.         .         .         .         .         .           g.37948
atgctaaaaactctcaataaattaggtattgatgggacgtatttcaaaataataagagct  c.58-2581

.         .         .         .         .         .           g.38008
atctatgacaaacccacagccaatatcatactgaatgggcaaaaactggaagcattccct  c.58-2521

.         .         .         .         .         .           g.38068
ttgaaaactggcacaagacagggatgccctctctcaccactcctattcaacatagtgttg  c.58-2461

.         .         .         .         .         .           g.38128
gaagttctggccagggcaattaggcaggagaaggaaataaagggtattcaattaggaaaa  c.58-2401

.         .         .         .         .         .           g.38188
gaggaagtcaaattgtccctgtgtgcagacgacatgattgtagatctagaaaaccccatt  c.58-2341

.         .         .         .         .         .           g.38248
gtctcagcccaaaatctccttaagctgataagcaacttcagcaaagtctcgggatacaaa  c.58-2281

.         .         .         .         .         .           g.38308
atcaatgtgcaaaaatcacaggcattcttatacaccaacaacagacaaacagagagccaa  c.58-2221

.         .         .         .         .         .           g.38368
atcatgagtgaactcccattcacaattacttcaaagagaatgaaatacctaggaatccaa  c.58-2161

.         .         .         .         .         .           g.38428
cttacaagggatgtgaaggacctcttcaaggagaactacaaaccactgctcaaggaaata  c.58-2101

.         .         .         .         .         .           g.38488
aaagaggttacaaacaaatggaagaacattccatgctcatgggtaggaagaatcaatatc  c.58-2041

.         .         .         .         .         .           g.38548
gtgaaaatggccatactgcccaaggtaatttacagattcaatgccatccccatcaagcta  c.58-1981

.         .         .         .         .         .           g.38608
ccaatgcctttcttcacagaattggaaaaaactactttaaagttcatatggaaccaaaaa  c.58-1921

.         .         .         .         .         .           g.38668
agagcccgcattgccaagtcaatcctaagccaaaagaacaaagctggaggcatcacacta  c.58-1861

.         .         .         .         .         .           g.38728
cctgacttcaaactatactacaaggctacagtaaccaaaacagcatggtactggtaccaa  c.58-1801

.         .         .         .         .         .           g.38788
aacagagatatagatcaatggaacagaacacagccctcagaaataacgccgcatatctac  c.58-1741

.         .         .         .         .         .           g.38848
aactatctgatctttgacaaacctgagaaaaacaagcaatggggaaaggattccctattt  c.58-1681

.         .         .         .         .         .           g.38908
attaaatggtgctgggaaaactggctagccatatgtagaaagctgaaactggatcccttc  c.58-1621

.         .         .         .         .         .           g.38968
cttacaccttatacaaaaatcaattcaagatggattaaagacttaaacgttagacctaaa  c.58-1561

.         .         .         .         .         .           g.39028
accataaaaaccctagaagaaaacctaggcattaccattcaggacataggcatgggcaag  c.58-1501

.         .         .         .         .         .           g.39088
gacttcgtgtctaaaacaccaaaagcaatggcaacaaaagacaaaattgacaaatgggat  c.58-1441

.         .         .         .         .         .           g.39148
ctaattcaactaaagagcttctgcacagcaaaagaaactaccatcagagtcaacaggcaa  c.58-1381

.         .         .         .         .         .           g.39208
cctacaaaatgggagaaaattttcgcaacctactcatctgacaaagggctaatatccaga  c.58-1321

.         .         .         .         .         .           g.39268
atctacaatgaactcaaacaaatttacaagaggaaaacaaacaaccccatcaaaaagtgg  c.58-1261

.         .         .         .         .         .           g.39328
gcaaaggacatgaacagacacttctcaaaagaagacatttatgcagccaaaaaacacatg  c.58-1201

.         .         .         .         .         .           g.39388
aaaaaatgctcatcatcactggccatcagagaaatgcaaatcaaaaccacaatgagatac  c.58-1141

.         .         .         .         .         .           g.39448
catctcactccagttagaatggcaatcattaaaaagtcaggaaacaacaggtgctggaga  c.58-1081

.         .         .         .         .         .           g.39508
ggatgtagagaaataggaacacttttacactgttggtgggactgtaaactagttcaacca  c.58-1021

.         .         .         .         .         .           g.39568
ttgtggaagtcagtgtggcgattcctcagggatctagaactggaaataccatttgaccca  c.58-961

.         .         .         .         .         .           g.39628
gccatcccattgctgggtatatacccaaagaactataaatcatgctgctataaagacaca  c.58-901

.         .         .         .         .         .           g.39688
tgcacacgtatgtttattgcggcattattcacaatagcaaagacttggaaccaacccaaa  c.58-841

.         .         .         .         .         .           g.39748
tgtccaacaatgatagactggattcagaaaatgtggcatatatacaccatggaatactat  c.58-781

.         .         .         .         .         .           g.39808
gcagccatagaaaatgaggagttcatgtcctttgtagggacatggatgaaattggaaatc  c.58-721

.         .         .         .         .         .           g.39868
atcattctcagtaaactatcgcaagaacaaaaaaccaaacaccgcatattctcactcata  c.58-661

.         .         .         .         .         .           g.39928
ggtgggaattgaacaatgagatcacatggacacaggaaggggaatatcacactctgggga  c.58-601

.         .         .         .         .         .           g.39988
ctgttgtggggtggggggaggggggagggataacatcaggagatatacctaatgctagat  c.58-541

.         .         .         .         .         .           g.40048
gacgagttagtgggtgcagcgcaccagcatggcacatgtatacatatgtaactaacctgc  c.58-481

.         .         .         .         .         .           g.40108
acaatgtgcacatgtaccctaaaacttaaagtataataataaaaaaaaaagaaaggaaat  c.58-421

.         .         .         .         .         .           g.40168
ttggtaagatctatcaaaatgggaaatgtgcatacattttactgaccattttcattttaa  c.58-361

.         .         .         .         .         .           g.40228
agattaaccttaaagatataatctcagaagtggaagaagctatatgcccagaaatgtttg  c.58-301

.         .         .         .         .         .           g.40288
tttctgaagtgcttagagtagtaataattttggaatatcttaaatgtctatcaataggaa  c.58-241

.         .         .         .         .         .           g.40348
aattatataaattctgataatatataaaatttattattattattatgtacccatcacagt  c.58-181

.         .         .         .         .         .           g.40408
tgtaactttacatataatgagattatttgcttccctatatctctctgtccatagatgatg  c.58-121

.         .         .         .         .         .           g.40468
gagtacatgagattaagaatgtccatgtttgtctctagcaactggctcatttcctattag  c.58-61

.         .         .         .         .         .           g.40528
gaactaaatacatacttattgaacaaacaaatgaactgaggtctctctttatcttaatag  c.58-1


Powered by LOVD v.3.0 Build 22
©2004-2020 Leiden University Medical Center