chloride intracellular channel 2 (CLIC2) - 125 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.40698
gtaagagaaatcaggacatgttaaattctaggaattgagattggtagataccaataaaat  c.167+60

     g.40701
att  c.167+63

--------------------- middle of intron ---------------------
                                                g.40702       g.40703
                                                c.168-62  gg  c.168-61

.         .         .         .         .         .           g.40763
tgtttatttaatgtgtactttatctagagacctaactctgcttatttttaataatcatag  c.168-1


Powered by LOVD v.3.0 Build 22
©2004-2020 Leiden University Medical Center