chloride intracellular channel 2 (CLIC2) - 631 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.59796
gtaagatacctttctttaaatctctatttttctctcactcttcatcttctcactcagcaa  c.400+60

         .         .         .         .         .         .  g.59856
aaatagaattttcctgaatatatagtatattttggggactggcctagtcttcccctcatt  c.400+120

         .         .         .         .         .         .  g.59916
ctctatactctcctctgaaattccctcgcatgaagttgtattagatttagaactcaagat  c.400+180

         .         .         .         .         .         .  g.59976
tcaatatagctattaccaaccatagctcaattagaatattgacatactaggtgtgaacta  c.400+240

         .         .         .         .         .         .  g.60036
actgcaggactgtgtacctttaaggtttcttaaactgtggcacctaccatttcccatgaa  c.400+300

         .        g.60052
cattcttaaatagatt  c.400+316

--------------------- middle of intron ---------------------
                                  g.60053         .           g.60067
                                  c.401-315  tattatcctctgagt  c.401-301

.         .         .         .         .         .           g.60127
cacaagaactgtgttttttctttcactttctaactcttctgatcacttttctttctttct  c.401-241

.         .         .         .         .         .           g.60187
tttactctcctgccaatgcacctccctaagaaaagcccaaaagattaacactcactattt  c.401-181

.         .         .         .         .         .           g.60247
catcttactttgtcttatcagtgagtagctgagcattctaaatagttaactagatattga  c.401-121

.         .         .         .         .         .           g.60307
agagccagtgtaagtagtatgtatagatagaggtgtctaaatgtgtggaaagcatattta  c.401-61

.         .         .         .         .         .           g.60367
gaatgtatttagtcaaaagacaatacatttacaagtaactctattacttcattgcctcag  c.401-1


Powered by LOVD v.3.0 Build 22
©2004-2020 Leiden University Medical Center