ceroid-lipofuscinosis, neuronal 3 (CLN3) - coding DNA reference sequence

(used for variant description)

(last modified July 12, 2013)


This file was created to facilitate the description of sequence variants on transcript NM_001042432.1 in the CLN3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering CLN3 transcript NM_001042432.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5059
  ataactggtgctggcaggctactgtctcggtcttgggcgccactgatctaaggtcacgg       c.-301

 .         .         .         .         .         .                g.5119
 ctctgcttgctgctcccacccgctccagtttaaaacctgcggttccagggttctccagcc       c.-241

 .         .         .         .         .         .                g.5179
 cctccctttttcacgctccgaagccgagaaggcccaaagcgaagacagagaggacccgga       c.-181

 .         .         .         .         .         .                g.5239
 agtagggaaaacctctgagcacgtgatgggggaacacgcgggtgctgtcacgtgatccga       c.-121

 .         .         .         .         .    | 02    .             g.5483
 caaacggcctctgcatagtgcagaacattctgctgctcttaaag | accctcatccctcccg    c.-61

 .         .         .         .         .         .                g.5543
 tgggagccccctttggacactctatgaccctggaccctcgggggacctgaacttgatgcg       c.-1

          .         .         .         .       | 03 .         .    g.5756
 ATGGGAGGCTGTGCAGGCTCGCGGCGGCGCTTTTCGGATTCCGAGG | GGGAGGAGACCGTC    c.60
 M  G  G  C  A  G  S  R  R  R  F  S  D  S  E  G |   E  E  T  V      p.20

          .         .         .         .         .         .       g.5816
 CCGGAGCCCCGGCTCCCTCTGTTGGACCATCAGGGCGCGCATTGGAAGAACGCGGTGGGC       c.120
 P  E  P  R  L  P  L  L  D  H  Q  G  A  H  W  K  N  A  V  G         p.40

       | 04  .         .         .         .         .         .    g.7971
 TTCTG | GCTGCTGGGCCTTTGCAACAACTTCTCTTATGTGGTGATGCTGAGTGCCGCCCAC    c.180
 F  W  |  L  L  G  L  C  N  N  F  S  Y  V  V  M  L  S  A  A  H      p.60

          .         .         .         .   | 05     .         .    g.8658
 GACATCCTTAGCCACAAGAGGACATCGGGAAACCAGAGCCAT | GTGGACCCAGGCCCAACG    c.240
 D  I  L  S  H  K  R  T  S  G  N  Q  S  H   | V  D  P  G  P  T      p.80

          .         .         .         .         .     | 06   .    g.9567
 CCGATCCCCCACAACAGCTCATCACGATTTGACTGCAACTCTGTCTCTACGGCT | GCTGTG    c.300
 P  I  P  H  N  S  S  S  R  F  D  C  N  S  V  S  T  A   | A  V      p.100

          .         .         .         .         .         .       g.9627
 CTCCTGGCGGACATCCTCCCCACACTCGTCATCAAATTGTTGGCTCCTCTTGGCCTTCAC       c.360
 L  L  A  D  I  L  P  T  L  V  I  K  L  L  A  P  L  G  L  H         p.120

          .     | 07   .         .         .         .         .    g.9807
 CTGCTGCCCTACAG | CCCCCGGGTTCTCGTCAGTGGGATTTGTGCTGCTGGAAGCTTCGTC    c.420
 L  L  P  Y  S  |  P  R  V  L  V  S  G  I  C  A  A  G  S  F  V      p.140

          .         .         .         . | 08       .         .    g.10672
 CTGGTTGCCTTTTCTCATTCTGTGGGGACCAGCCTGTGTG | GTGTGGTCTTCGCTAGCATC    c.480
 L  V  A  F  S  H  S  V  G  T  S  L  C  G |   V  V  F  A  S  I      p.160

          .         .         .         .         .    | 09    .    g.10819
 TCATCAGGCCTTGGGGAGGTCACCTTCCTCTCCCTCACTGCCTTCTACCCCAG | GGCCGTG    c.540
 S  S  G  L  G  E  V  T  F  L  S  L  T  A  F  Y  P  R  |  A  V      p.180

          .         .         .         .         .         .       g.10879
 ATCTCCTGGTGGTCCTCAGGGACTGGGGGAGCTGGGCTGCTGGGGGCCCTGTCCTACCTG       c.600
 I  S  W  W  S  S  G  T  G  G  A  G  L  L  G  A  L  S  Y  L         p.200

          .         .         .         .         .         .       g.10939
 GGCCTCACCCAGGCCGGCCTCTCCCCTCAGCAGACCCTGCTGTCCATGCTGGGTATCCCT       c.660
 G  L  T  Q  A  G  L  S  P  Q  Q  T  L  L  S  M  L  G  I  P         p.220

          .        | 10.         .         .         .         .    g.13227
 GCCCTGCTGCTGGCCAG | CTATTTCTTGTTGCTCACATCTCCTGAGGCCCAGGACCCTGGA    c.720
 A  L  L  L  A  S  |  Y  F  L  L  L  T  S  P  E  A  Q  D  P  G      p.240

          .         .         .         .         .         .       g.13287
 GGGGAAGAAGAAGCAGAGAGCGCAGCCCGGCAGCCCCTCATAAGAACCGAGGCCCCGGAG       c.780
 G  E  E  E  A  E  S  A  A  R  Q  P  L  I  R  T  E  A  P  E         p.260

          . | 11       .         .         .         .        | 12. g.14760
 TCGAAGCCAG | GCTCCAGCTCCAGCCTCTCCCTTCGGGAAAGGTGGACAGTGTTCAAG | GGT c.840
 S  K  P  G |   S  S  S  S  L  S  L  R  E  R  W  T  V  F  K   | G   p.280

          .         .         .         .         .         .       g.14820
 CTGCTGTGGTACATTGTTCCCTTGGTCGTAGTTTACTTTGCCGAGTATTTCATTAACCAG       c.900
 L  L  W  Y  I  V  P  L  V  V  V  Y  F  A  E  Y  F  I  N  Q         p.300

        | 13 .         .         .         .         .         .    g.14974
 GGACTT | TTTGAACTCCTCTTTTTCTGGAACACTTCCCTGAGTCACGCTCAGCAATACCGC    c.960
 G  L   | F  E  L  L  F  F  W  N  T  S  L  S  H  A  Q  Q  Y  R      p.320

    | 14     .         .         .         .         .         .    g.15162
 TG | GTACCAGATGCTGTACCAGGCTGGCGTCTTTGCCTCCCGCTCTTCTCTCCGCTGCTGT    c.1020
 W  |  Y  Q  M  L  Y  Q  A  G  V  F  A  S  R  S  S  L  R  C  C      p.340

          .         .         .       | 15 .         .         .    g.19449
 CGCATCCGTTTCACCTGGGCCCTGGCCCTGCTGCAG | TGCCTCAACCTGGTGTTCCTGCTG    c.1080
 R  I  R  F  T  W  A  L  A  L  L  Q   | C  L  N  L  V  F  L  L      p.360

          .         .         .         .         .         .       g.19509
 GCAGACGTGTGGTTCGGCTTTCTGCCAAGCATCTACCTCGTCTTCCTGATCATTCTGTAT       c.1140
 A  D  V  W  F  G  F  L  P  S  I  Y  L  V  F  L  I  I  L  Y         p.380

          .         .         .         .         .        | 16.    g.19670
 GAGGGGCTCCTGGGAGGCGCAGCCTACGTGAACACCTTCCACAACATCGCCCTGGAG | ACC    c.1200
 E  G  L  L  G  G  A  A  Y  V  N  T  F  H  N  I  A  L  E   | T      p.400

          .         .         .         .         .         .       g.19730
 AGTGATGAGCACCGGGAGTTTGCAATGGCGGCCACCTGCATCTCTGACACACTGGGGATC       c.1260
 S  D  E  H  R  E  F  A  M  A  A  T  C  I  S  D  T  L  G  I         p.420

          .         .         .         .         .                 g.19787
 TCCCTGTCGGGGCTCCTGGCTTTGCCTCTGCATGACTTCCTCTGCCAGCTCTCCTGA          c.1317
 S  L  S  G  L  L  A  L  P  L  H  D  F  L  C  Q  L  S  X            p.438

          .         .         .         .         .         .       g.19847
 tactcgggatcctcaggacgcaggtcacattcacctgtgggcagagggacaggtcagaca       c.*60

          .         .         .         .         .         .       g.19907
 cccaggcccaccccagagaccctccatgaactgtgctcccagccttcccggcaggtctgg       c.*120

          .         .         .         .         .         .       g.19967
 gagtagggaagggctgaagccttgtttcccttgcaggggggccagccattgtctcccact       c.*180

          .         .         .         .         .                 g.20024
 tggggagtttcttcctggcatcatgccttctgaataaatgccgattttatccatgga          c.*237

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Ceroid-lipofuscinosis, neuronal 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 06
©2004-2013 Leiden University Medical Center