collagen, type IV, alpha 4 (COL4A4) - 92 nt intron 39 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .        g.137458
gtaagctgtagcatgctttgcccttctttcaataactaaaccaaaa  c.3706+46

--------------------- middle of intron ---------------------
   g.137459         .         .         .         .           g.137504
   c.3707-46  ccttccaaatgcaatgaggataacatgtgaacatgtctcttcttag  c.3707-1


Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center