COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX16) - coding DNA reference sequence

(used for variant description)

(last modified October 1, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_016468.6 in the COX16 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000014.8, covering COX16 transcript NM_016468.6.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5024
                                     attcactaaggaccgagcaccaaa       c.-121

 .         .         .         .         .         .                g.5084
 taaccaaggaaaaggaagtgagttaaggacgtactcgtcttggtgagagcgtgagctgct       c.-61

 .         .         .         .         .         .                g.5144
 gagatttgggagtctgcgctaggcccgcttggagttctgagccgatggaagagttcactc       c.-1

          .         .         .         .         .         .       g.5204
 ATGTTTGCACCCGCGGTGATGCGTGCTTTTCGCAAGAACAAGACTCTCGGCTATGGAGTC       c.60
 M  F  A  P  A  V  M  R  A  F  R  K  N  K  T  L  G  Y  G  V         p.20

           | 02        .         .         .         .         .    g.22053
 CCCATGTTG | TTGCTGATTGTTGGAGGTTCTTTTGGTCTTCGTGAGTTTTCTCAAATCCGA    c.120
 P  M  L   | L  L  I  V  G  G  S  F  G  L  R  E  F  S  Q  I  R      p.40

          .         .  | 03      .         .         .         .    g.35534
 TATGATGCTGTGAAGAGTAAA | ATGGATCCTGAGCTTGAAAAAAAACTGAAAGAGAATAAA    c.180
 Y  D  A  V  K  S  K   | M  D  P  E  L  E  K  K  L  K  E  N  K      p.60

          .         .     | 04   .         .         .         .    g.38318
 ATATCTTTAGAGTCGGAATATGAG | AAAATCAAAGACTCCAAGTTTGATGACTGGAAGAAT    c.240
 I  S  L  E  S  E  Y  E   | K  I  K  D  S  K  F  D  D  W  K  N      p.80

          .         .         .         .         .         .       g.38378
 ATTCGAGGACCCAGGCCTTGGGAAGATCCTGACCTCCTCCAAGGAAGAAATCCAGAAAGC       c.300
 I  R  G  P  R  P  W  E  D  P  D  L  L  Q  G  R  N  P  E  S         p.100

          .         .                                               g.38399
 CTTAAGACTAAGACAACTTGA                                              c.321
 L  K  T  K  T  T  X                                                p.106

          .         .         .         .         .         .       g.38459
 ctctgctgattcttttttccttttttttttttttaaataaaaatattattaactggactt       c.*60

          .         .         .         .         .         .       g.38519
 cctaatatatacttctatcaagtggaaaggaaattccaggcccatggaaacttggatatg       c.*120

          .         .         .         .         .         .       g.38579
 ggtaatttgatgacaaataatcttcactaaaggtcatgtacaggtttttatacttcccag       c.*180

          .         .         .         .         .         .       g.38639
 ctattccatctgtggatgaaagtaacaatgttggccacgtatattttacacctcgaaata       c.*240

          .         .         .         .         .         .       g.38699
 aaaaatgtgaatactgctccaaaaacagagtcacgtattccactctccaactacccacat       c.*300

          .         .         .         .         .         .       g.38759
 attccttttgcaatagccattagggcatcattttgatatttcattctgatttctgattct       c.*360

          .         .         .         .         .         .       g.38819
 ctgatttctgattcctaatgaggacagtaggtctggatccaaattctcacagtaaaatca       c.*420

          .         .         .         .         .         .       g.38879
 agcagtaattttctctcatatctattagggaaagaaaaatgatcacagtctgctaagagt       c.*480

          .         .         .         .         .         .       g.38939
 cttgattttctttgtaatgcctcacatagtatgataatcagtctccaaagcatcacatga       c.*540

          .         .         .         .         .         .       g.38999
 taattacaatgataccattaacatgtcaaggaaattatattatttatggttgtcaaaaat       c.*600

          .         .         .         .         .         .       g.39059
 tatgaagtagtgtatgattataagcagatatggcaaatttgttcagtaaatccatagatg       c.*660

          .         .         .         .         .         .       g.39119
 actacattttgagaaatactaagataatactaaaaattatgccttagcataatttgcatg       c.*720

          .         .         .         .         .         .       g.39179
 caaaattgccctctagtgtttttgttttgttttgagacatagtctcgctctgttcgccca       c.*780

          .         .         .         .         .         .       g.39239
 ggctggagtgcaggggcacgatctctgctcactgcaagctctgcttcccgggttcacacc       c.*840

          .         .         .         .         .         .       g.39299
 attctcctgcctcagcatcctgagtagctgggactacaggcacatgctgtcacacccggc       c.*900

          .         .         .         .         .         .       g.39359
 taattttttgtatttagtagagatggggtttcaccacgttagccaggatggtctccatct       c.*960

          .         .         .         .         .         .       g.39419
 cctgaccttgtgatccgcccacctcggcctcacaaattgctgggattacaggtgtgagcc       c.*1020

          .         .         .         .         .         .       g.39479
 accacgcctggccgaaagttagttgttttgaactcattttctcctttttacccctgcctt       c.*1080

          .         .         .         .         .         .       g.39539
 tatcagcttctaccttctggtttcatgctgagttctagttgcctaaagtctccattgaaa       c.*1140

          .         .         .         .         .         .       g.39599
 cactcctgttataattgccataaaatcataaatccactccccctttctcctcctagtcaa       c.*1200

          .         .         .         .         .                 g.39651
 aatttgtattcttttcagcaggttggttttaataaaaagtaaattaagttga               c.*1252

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.