cytochrome c oxidase subunit Va (COX5A) - coding DNA reference sequence

(used for variant description)

(last modified July 23, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_004255.3 in the COX5A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000015.9, covering COX5A transcript NM_004255.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5020
                                         gcccacgcgccagagtcgca       c.-121

 .         .         .         .         .         .                g.5080
 gtgggcgggcctacgtgctccgcccgctgtgagcctgtccggcccccgcccgctccggag       c.-61

 .         .         .         .         .         .                g.5140
 caacccgcgagcttacaccggcttctctctgtcctcagcccgcgcgccgccatcgccgtc       c.-1

          .         .         .         .         .         .       g.5200
 ATGCTGGGCGCCGCTCTCCGCCGCTGCGCTGTGGCCGCAACCACCCGGGCCGACCCTCGA       c.60
 M  L  G  A  A  L  R  R  C  A  V  A  A  T  T  R  A  D  P  R         p.20

          .         .         .         . | 02       .         .    g.13942
 GGCCTCCTGCACTCCGCCCGGACCCCCGGCCCCGCCGTGG | CTATCCAGTCAGTTCGCTGC    c.120
 G  L  L  H  S  A  R  T  P  G  P  A  V  A |   I  Q  S  V  R  C      p.40

          .         .         .         .         .         .       g.14002
 TATTCCCATGGGTCACAGGAGACAGATGAGGAGTTTGATGCTCGCTGGGTAACATACTTC       c.180
 Y  S  H  G  S  Q  E  T  D  E  E  F  D  A  R  W  V  T  Y  F         p.60

          .         .         .        | 03.         .         .    g.16290
 AACAAGCCAGATATAGATGCCTGGGAATTGCGTAAAG | GGATAAACACACTTGTTACCTAT    c.240
 N  K  P  D  I  D  A  W  E  L  R  K  G |   I  N  T  L  V  T  Y      p.80

          .         .         .         .         .         .       g.16350
 GATATGGTTCCAGAGCCCAAAATCATTGATGCTGCTTTGCGGGCATGCAGACGGTTAAAT       c.300
 D  M  V  P  E  P  K  I  I  D  A  A  L  R  A  C  R  R  L  N         p.100

          .         .         .          | 04        .         .    g.19405
 GATTTTGCTAGTACAGTTCGTATCCTAGAGGTTGTTAAG | GACAAAGCAGGACCTCATAAG    c.360
 D  F  A  S  T  V  R  I  L  E  V  V  K   | D  K  A  G  P  H  K      p.120

          .         .         .         .         .         .       g.19465
 GAAATCTACCCCTATGTCATCCAGGAACTTAGACCAACTTTAAATGAACTGGGAATCTCC       c.420
 E  I  Y  P  Y  V  I  Q  E  L  R  P  T  L  N  E  L  G  I  S         p.140

          .         .         .                                 g.19498
 ACTCCGGAGGAACTGGGCCTTGACAAAGTGTAA |                               c.454
 T  P  E  E  L  G  L  D  K  V  X                                 p.150

           | 05        .         .         .         .         .    g.22763
 accgcatgg | atgggcttccccaaggatttattgacattgctacttgagtgtgaacagtta    c.*60

          .         .         .         .         .         .       g.22823
 cctggaaatactgatgataacatattaccttatttgaacaagttttcctttattgagtac       c.*120

          .         .         .         .         .                 g.22880
 caagccatgtaatggtaacttggactttaataaaagggaaatgagtttgaactgaaa          c.*177

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Cytochrome c oxidase subunit Va protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.