CASP2 and RIPK1 domain containing adaptor with death domain (CRADD) - coding DNA reference sequence

(used for variant description)

(last modified November 26, 2023)

This file was created to facilitate the description of sequence variants on transcript NM_003805.3 in the CRADD gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000012.11, covering CRADD transcript NM_003805.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5044
                 gccattaacaaagatggtgcttatggggcaggttccctaacagt       c.-61

 .         .         .         .         .         .    | 02        g.6400
 caggattccggttgcagtttttctcccccgccccaaagatacgtggttgcagac | ggagaa    c.-1

          .         .         .         .         .         .       g.6460
 ATGGAGGCCAGAGACAAACAAGTACTCCGCTCACTTCGCCTGGAGCTGGGTGCAGAGGTA       c.60
 M  E  A  R  D  K  Q  V  L  R  S  L  R  L  E  L  G  A  E  V         p.20

          .         .         .         .         .         .       g.6520
 TTGGTGGAGGGACTGGTTCTTCAGTACCTCTACCAGGAAGGAATCTTGACGGAAAACCAT       c.120
 L  V  E  G  L  V  L  Q  Y  L  Y  Q  E  G  I  L  T  E  N  H         p.40

          .         .         .         .         .         .       g.6580
 ATTCAAGAAATCAATGCTCAAACCACAGGCCTCCGGAAAACAATGCTCCTGCTGGATATC       c.180
 I  Q  E  I  N  A  Q  T  T  G  L  R  K  T  M  L  L  L  D  I         p.60

          .         .         .         .         .         .       g.6640
 CTACCTTCCAGGGGCCCTAAAGCATTTGATACATTCCTAGATTCCCTACAGGAGTTTCCC       c.240
 L  P  S  R  G  P  K  A  F  D  T  F  L  D  S  L  Q  E  F  P         p.80

          .         .         .         .         .         | 03    g.177597
 TGGGTCAGGGAGAAGCTGAAGAAGGCAAGGGAAGAGGCCATGACCGACCTGCCTGCAG | GT    c.300
 W  V  R  E  K  L  K  K  A  R  E  E  A  M  T  D  L  P  A  G |       p.100

          .         .         .         .         .         .       g.177657
 GACAGATTGACTGGGATCCCCTCGCACATCCTCAACAGCTCCCCATCAGACCGGCAGATT       c.360
 D  R  L  T  G  I  P  S  H  I  L  N  S  S  P  S  D  R  Q  I         p.120

          .         .         .         .         .         .       g.177717
 AACCAGCTGGCCCAGAGGCTGGGCCCTGAGTGGGAGCCCATGGTGCTGTCTCTGGGACTG       c.420
 N  Q  L  A  Q  R  L  G  P  E  W  E  P  M  V  L  S  L  G  L         p.140

          .         .         .         .         .         .       g.177777
 TCCCAGACGGATATCTACCGCTGTAAGGCCAACCACCCCCACAACGTGCAGTCGCAGGTG       c.480
 S  Q  T  D  I  Y  R  C  K  A  N  H  P  H  N  V  Q  S  Q  V         p.160

          .         .         .         .         .         .       g.177837
 GTGGAGGCCTTCATCCGTTGGCGGCAGCGCTTCGGGAAGCAGGCCACCTTCCAGAGCCTG       c.540
 V  E  A  F  I  R  W  R  Q  R  F  G  K  Q  A  T  F  Q  S  L         p.180

          .         .         .         .         .         .       g.177897
 CACAACGGGCTGCGGGCTGTGGAGGTGGACCCCTCGCTGCTCCTGCACATGTTGGAGTGA       c.600
 H  N  G  L  R  A  V  E  V  D  P  S  L  L  L  H  M  L  E  X         p.199

          .         .         .         .         .         .       g.177957
 tggtgcctccagcaaccgctggggagtgtgtccctgagtcatgtgggctgaatcctgact       c.*60

          .         .         .         .         .         .       g.178017
 ttcactcagagcaggtggttttttgtgtaggtttgttttttatttttgatgatcttcaga       c.*120

          .         .         .         .         .         .       g.178077
 tggaaggagaaaacagggtttccactagacattacttgaaaggccagattactcagcaga       c.*180

          .         .         .         .         .         .       g.178137
 tctcccatgttggctcaacaattctttgtttttaattgcttgaagattgcattgttgtaa       c.*240

          .         .         .         .         .         .       g.178197
 ttgttcagtttttaaatgtgtaatggcattttaatagactagtaaatcacagtggttcaa       c.*300

          .         .         .         .         .         .       g.178257
 aatatatatccatatatatatatatccatatatatatctcatgtcatcacattacaggca       c.*360

          .         .         .         .         .         .       g.178317
 ggtgtctcatatgtaaaacatttacctgaatgttgtctgaggactgaactgtggacttta       c.*420

          .         .         .         .         .         .       g.178377
 ctattcataatgataaaataataaaatgcgaattactatatataatgtgcctcactcatg       c.*480

                                                                    g.178382
 agaaa                                                              c.*485

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The CASP2 and RIPK1 domain containing adaptor with death domain protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.