crumbs homolog 1 (Drosophila) (CRB1) - coding DNA reference sequence

(used for variant description)

(last modified February 27, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_201253.2 in the CRB1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008483.1, covering CRB1 transcript NM_201253.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.4955
                                cctcccgtgtaagtgatgctaagaagcac       c.-181

 .         .         .         .         .         .                g.5015
 aaactgcattttgaatctaagtccctgtattttctgtgaaggagctgtaagtagggtggg       c.-121

 .         .         .         .         .         .                g.5075
 acagagatggcacctgggggttctgaggcacccgctcctctctgagacagacagggatca       c.-61

 .         .         .         .         .         .                g.5135
 ggagccggactgggaccagaccaccagcaacacaccagaggatgttctctaaataagacc       c.-1

          .         .         .         .         .         .       g.5195
 ATGGCACTTAAGAACATTAACTACCTTCTCATCTTCTACCTCAGTTTCTCACTGCTTATC       c.60
 M  A  L  K  N  I  N  Y  L  L  I  F  Y  L  S  F  S  L  L  I         p.20

          . | 02       .         .         .         .         .    g.65194
 TACATAAAAA | ATTCCTTTTGCAATAAAAACAACACCAGGTGCCTCTCAAATTCTTGCCAA    c.120
 Y  I  K  N |   S  F  C  N  K  N  N  T  R  C  L  S  N  S  C  Q      p.40

          .         .         .         .         .         .       g.65254
 AACAATTCTACATGCAAAGATTTTTCAAAAGACAATGATTGTTCTTGTTCAGACACAGCC       c.180
 N  N  S  T  C  K  D  F  S  K  D  N  D  C  S  C  S  D  T  A         p.60

          .         .         .         .         .         .       g.65314
 AATAATTTGGACAAAGACTGTGACAACATGAAAGACCCTTGCTTCTCCAATCCCTGTCAA       c.240
 N  N  L  D  K  D  C  D  N  M  K  D  P  C  F  S  N  P  C  Q         p.80

          .         .         .         .         .         .       g.65374
 GGAAGTGCCACTTGTGTGAACACCCCAGGAGAAAGGAGCTTTCTGTGCAAATGTCCTCCT       c.300
 G  S  A  T  C  V  N  T  P  G  E  R  S  F  L  C  K  C  P  P         p.100

          .         .         .         .         .         .       g.65434
 GGGTACAGTGGGACAATCTGTGAAACTACCATTGGTTCCTGTGGCAAGAACTCCTGCCAA       c.360
 G  Y  S  G  T  I  C  E  T  T  I  G  S  C  G  K  N  S  C  Q         p.120

          .         .         .         .         .         .       g.65494
 CATGGAGGTATTTGCCATCAGGACCCTATTTATCCTGTCTGCATCTGCCCTGCTGGATAT       c.420
 H  G  G  I  C  H  Q  D  P  I  Y  P  V  C  I  C  P  A  G  Y         p.140

          .         .         .         .         .         .       g.65554
 GCTGGAAGATTCTGTGAGATAGATCACGATGAGTGTGCTTCCAGCCCTTGCCAAAATGGG       c.480
 A  G  R  F  C  E  I  D  H  D  E  C  A  S  S  P  C  Q  N  G         p.160

          .         .         .         .         .         .       g.65614
 GCCGTGTGCCAGGATGGAATTGATGGTTACTCCTGCTTCTGTGTCCCAGGATATCAAGGC       c.540
 A  V  C  Q  D  G  I  D  G  Y  S  C  F  C  V  P  G  Y  Q  G         p.180

          .         .         .         .         .         .       g.65674
 AGACACTGCGACTTGGAAGTGGATGAATGTGCTTCAGATCCCTGCAAGAACGAGGCTACA       c.600
 R  H  C  D  L  E  V  D  E  C  A  S  D  P  C  K  N  E  A  T         p.200

          .         .         .         .         .   | 03     .    g.81011
 TGCCTCAATGAAATAGGAAGATATACTTGTATCTGTCCCCACAATTATTCTG | GTGTAAAC    c.660
 C  L  N  E  I  G  R  Y  T  C  I  C  P  H  N  Y  S  G |   V  N      p.220

          .         .         .         .         .         .       g.81071
 TGTGAATTGGAAATTGACGAATGTTGGTCCCAGCCTTGTTTAAATGGTGCAACTTGTCAG       c.720
 C  E  L  E  I  D  E  C  W  S  Q  P  C  L  N  G  A  T  C  Q         p.240

          .         .         .         .         .         .       g.81131
 GATGCTCTGGGGGCCTATTTCTGCGACTGTGCCCCTGGATTCCTGGGGGATCACTGTGAA       c.780
 D  A  L  G  A  Y  F  C  D  C  A  P  G  F  L  G  D  H  C  E         p.260

          .         .         .         .         .         .       g.81191
 CTCAACACTGATGAGTGTGCCAGTCAACCTTGTCTCCATGGAGGGCTGTGTGTGGATGGA       c.840
 L  N  T  D  E  C  A  S  Q  P  C  L  H  G  G  L  C  V  D  G         p.280

          | 04         .         .         .         .         .    g.84114
 GAAAACAG | ATATAGCTGTAACTGCACGGGTAGTGGATTCACAGGGACACACTGTGAGACC    c.900
 E  N  R  |  Y  S  C  N  C  T  G  S  G  F  T  G  T  H  C  E  T      p.300

          .         .         .         .         .         .       g.84174
 TTGATGCCTCTTTGTTGGTCAAAACCTTGTCACAATAATGCTACATGTGAGGACAGTGTT       c.960
 L  M  P  L  C  W  S  K  P  C  H  N  N  A  T  C  E  D  S  V         p.320

          .         .         | 05         .         .         .    g.93585
 GACAATTACACTTGTCACTGCTGGCCTG | GATACACAGGTGCCCAGTGTGAGATCGACCTC    c.1020
 D  N  Y  T  C  H  C  W  P  G |   Y  T  G  A  Q  C  E  I  D  L      p.340

          .         .         .         .         .         .       g.93645
 AATGAATGCAATAGTAACCCCTGCCAGTCCAATGGGGAATGTGTGGAGCTGTCCTCAGAG       c.1080
 N  E  C  N  S  N  P  C  Q  S  N  G  E  C  V  E  L  S  S  E         p.360

          .         .         .         .         .         .       g.93705
 AAACAATATGGACGCATCACTGGACTGCCTTCTTCTTTCAGCTACCATGAAGCCTCAGGT       c.1140
 K  Q  Y  G  R  I  T  G  L  P  S  S  F  S  Y  H  E  A  S  G         p.380

          .         .         .  | 06      .         .         .    g.157751
 TATGTCTGTATCTGTCAGCCTGGATTCACAG | GAATCCACTGCGAAGAAGACGTCAATGAA    c.1200
 Y  V  C  I  C  Q  P  G  F  T  G |   I  H  C  E  E  D  V  N  E      p.400

          .         .         .         .         .         .       g.157811
 TGTTCTTCAAACCCTTGCCAAAATGGTGGTACTTGTGAGAACTTGCCTGGGAATTATACT       c.1260
 C  S  S  N  P  C  Q  N  G  G  T  C  E  N  L  P  G  N  Y  T         p.420

          .         .         .         .         .         .       g.157871
 TGCCATTGCCCATTTGATAACCTTTCTAGAACTTTTTATGGAGGAAGGGACTGTTCTGAT       c.1320
 C  H  C  P  F  D  N  L  S  R  T  F  Y  G  G  R  D  C  S  D         p.440

          .         .         .         .         .         .       g.157931
 ATTCTCCTGGGCTGTACCCATCAGCAATGTCTAAATAATGGAACATGCATCCCTCACTTC       c.1380
 I  L  L  G  C  T  H  Q  Q  C  L  N  N  G  T  C  I  P  H  F         p.460

          .         .         .         .         .         .       g.157991
 CAAGATGGCCAGCATGGATTCAGCTGCCTGTGTCCATCTGGCTACACCGGGTCCCTGTGT       c.1440
 Q  D  G  Q  H  G  F  S  C  L  C  P  S  G  Y  T  G  S  L  C         p.480

          .         .         .         .         .         .       g.158051
 GAAATCGCAACCACACTTTCATTTGAGGGCGATGGCTTCCTGTGGGTCAAAAGTGGCTCA       c.1500
 E  I  A  T  T  L  S  F  E  G  D  G  F  L  W  V  K  S  G  S         p.500

          .         .         .         .         .         .       g.158111
 GTGACAACCAAGGGCTCAGTTTGTAACATAGCCCTCAGGTTTCAGACTGTTCAGCCAATG       c.1560
 V  T  T  K  G  S  V  C  N  I  A  L  R  F  Q  T  V  Q  P  M         p.520

          .         .         .         .         .         .       g.158171
 GCTCTTCTACTTTTCCGAAGCAACAGGGATGTGTTTGTGAAGCTGGAGCTGCTAAGTGGC       c.1620
 A  L  L  L  F  R  S  N  R  D  V  F  V  K  L  E  L  L  S  G         p.540

          .         .         .         .         .         .       g.158231
 TACATTCACTTATCAATTCAGGTCAATAATCAGTCAAAGGTGCTTCTGTTCATTTCCCAC       c.1680
 Y  I  H  L  S  I  Q  V  N  N  Q  S  K  V  L  L  F  I  S  H         p.560

          .         .         .         .         .         .       g.158291
 AACACCAGCGATGGAGAGTGGCATTTCGTGGAGGTAATATTTGCAGAGGCTGTGACCCTT       c.1740
 N  T  S  D  G  E  W  H  F  V  E  V  I  F  A  E  A  V  T  L         p.580

          .         .         .         .         .         .       g.158351
 ACCTTAATCGACGACTCCTGTAAGGAGAAATGCATCGCGAAAGCTCCTACTCCACTTGAA       c.1800
 T  L  I  D  D  S  C  K  E  K  C  I  A  K  A  P  T  P  L  E         p.600

          .         .         .         .         .         .       g.158411
 AGTGATCAATCAATATGTGCTTTTCAGAACTCCTTTTTGGGTGGTTTACCAGTGGGAATG       c.1860
 S  D  Q  S  I  C  A  F  Q  N  S  F  L  G  G  L  P  V  G  M         p.620

          .         .         .         .         .         .       g.158471
 ACCAGCAATGGTGTTGCTCTGCTTAACTTCTATAATATGCCATCCACACCTTCGTTTGTA       c.1920
 T  S  N  G  V  A  L  L  N  F  Y  N  M  P  S  T  P  S  F  V         p.640

          .         .         .         .         .         .       g.158531
 GGCTGTCTCCAAGACATTAAAATTGATTGGAATCACATTACCCTGGAGAACATCTCGTCT       c.1980
 G  C  L  Q  D  I  K  I  D  W  N  H  I  T  L  E  N  I  S  S         p.660

          .         .         .         .         .         .       g.158591
 GGCTCATCATTAAATGTCAAGGCAGGCTGTGTGAGAAAGGATTGGTGTGAAAGCCAACCT       c.2040
 G  S  S  L  N  V  K  A  G  C  V  R  K  D  W  C  E  S  Q  P         p.680

          .         .         .         .         .         .       g.158651
 TGTCAAAGCAGAGGACGCTGCATCAACTTGTGGCTGAGTTACCAGTGTGACTGCCACAGG       c.2100
 C  Q  S  R  G  R  C  I  N  L  W  L  S  Y  Q  C  D  C  H  R         p.700

          .         .         | 07         .         .         .    g.164208
 CCCTATGAAGGCCCCAACTGTCTGAGAG | AGTATGTGGCAGGCAGATTTGGCCAGGATGAC    c.2160
 P  Y  E  G  P  N  C  L  R  E |   Y  V  A  G  R  F  G  Q  D  D      p.720

          .         .         .         .         .         .       g.164268
 TCCACTGGTTATGTCATCTTTACTCTTGATGAGAGCTATGGAGACACCATCAGCCTCTCC       c.2220
 S  T  G  Y  V  I  F  T  L  D  E  S  Y  G  D  T  I  S  L  S         p.740

          .         .         .         .         .         .       g.164328
 ATGTTTGTCCGAACGCTTCAACCATCAGGCTTACTTCTAGCTTTGGAAAACAGCACTTAT       c.2280
 M  F  V  R  T  L  Q  P  S  G  L  L  L  A  L  E  N  S  T  Y         p.760

          .         .         .         .         .         .       g.164388
 CAATATATCCGTGTCTGGCTAGAGCGCGGCAGACTAGCAATGCTGACTCCAAACTCTCCC       c.2340
 Q  Y  I  R  V  W  L  E  R  G  R  L  A  M  L  T  P  N  S  P         p.780

          .         .         .         .         .         .       g.164448
 AAATTAGTAGTAAAATTTGTTCTTAATGATGGAAATGTCCACTTGATATCTTTGAAAATC       c.2400
 K  L  V  V  K  F  V  L  N  D  G  N  V  H  L  I  S  L  K  I         p.800

          .         .         .         .         .         .       g.164508
 AAGCCATATAAAATTGAACTGTATCAGTCTTCACAAAACCTAGGATTTATTTCTGCTTCT       c.2460
 K  P  Y  K  I  E  L  Y  Q  S  S  Q  N  L  G  F  I  S  A  S         p.820

          .         .         .         .         .         .       g.164568
 ACGTGGAAAATCGAAAAGGGAGATGTCATCTACATTGGTGGCCTACCTGACAAGCAAGAG       c.2520
 T  W  K  I  E  K  G  D  V  I  Y  I  G  G  L  P  D  K  Q  E         p.840

          .         .         .         .         .         .       g.164628
 ACTGAACTTAATGGTGGATTCTTCAAAGGCTGTATCCAAGATGTAAGACTAAACAACCAA       c.2580
 T  E  L  N  G  G  F  F  K  G  C  I  Q  D  V  R  L  N  N  Q         p.860

          .         .         .         .         .         .       g.164688
 AATCTGGAATTCTTTCCAAATCCAACAAACAATGCATCTCTCAATCCAGTTCTTGTCAAT       c.2640
 N  L  E  F  F  P  N  P  T  N  N  A  S  L  N  P  V  L  V  N         p.880

          .         .         .       | 08 .         .         .    g.166195
 GTAACCCAAGGCTGTGCTGGAGACAACAGCTGCAAG | TCCAACCCCTGTCACAATGGAGGT    c.2700
 V  T  Q  G  C  A  G  D  N  S  C  K   | S  N  P  C  H  N  G  G      p.900

          .         .         .         .         .         .       g.166255
 GTTTGCCATTCCCGGTGGGATGACTTCTCCTGTTCCTGTCCTGCCCTCACAAGTGGGAAA       c.2760
 V  C  H  S  R  W  D  D  F  S  C  S  C  P  A  L  T  S  G  K         p.920

          .         .         .         .         .         .       g.166315
 GCCTGTGAGGAGGTTCAGTGGTGTGGATTCAGCCCGTGTCCTCACGGAGCCCAGTGCCAG       c.2820
 A  C  E  E  V  Q  W  C  G  F  S  P  C  P  H  G  A  Q  C  Q         p.940

          .         .   | 09     .         .         .         .    g.171466
 CCGGTGCTTCAAGGATTTGAAT | GTATTGCAAATGCTGTTTTTAATGGACAAAGCGGTCAA    c.2880
 P  V  L  Q  G  F  E  C |   I  A  N  A  V  F  N  G  Q  S  G  Q      p.960

          .         .         .         .         .         .       g.171526
 ATATTATTCAGAAGCAATGGGAATATTACCAGAGAACTCACCAATATCACATTTGGTTTC       c.2940
 I  L  F  R  S  N  G  N  I  T  R  E  L  T  N  I  T  F  G  F         p.980

          .         .         .         .         .         .       g.171586
 AGAACAAGGGATGCAAATGTAATAATATTGCATGCAGAAAAAGAGCCTGAATTTCTTAAT       c.3000
 R  T  R  D  A  N  V  I  I  L  H  A  E  K  E  P  E  F  L  N         p.1000

          .         .         .         .         .         .       g.171646
 ATTAGCATTCAAGATTCCAGATTATTCTTTCAATTGCAAAGTGGCAACAGCTTTTATATG       c.3060
 I  S  I  Q  D  S  R  L  F  F  Q  L  Q  S  G  N  S  F  Y  M         p.1020

          .         .         .         .         .         .       g.171706
 CTAAGTCTGACAAGTTTGCAGTCAGTGAATGATGGCACATGGCACGAAGTGACCCTTTCC       c.3120
 L  S  L  T  S  L  Q  S  V  N  D  G  T  W  H  E  V  T  L  S         p.1040

          .         .         .         .         .         .       g.171766
 ATGACAGACCCACTGTCCCAGACCTCCAGGTGGCAAATGGAAGTGGACAACGAAACACCT       c.3180
 M  T  D  P  L  S  Q  T  S  R  W  Q  M  E  V  D  N  E  T  P         p.1060

          .         .         .         .         .         .       g.171826
 TTTGTGACCAGCACAATTGCTACTGGAAGCCTCAACTTTTTGAAGGATAATACAGATATT       c.3240
 F  V  T  S  T  I  A  T  G  S  L  N  F  L  K  D  N  T  D  I         p.1080

          .         .         .         .         .         .       g.171886
 TATGTGGGAGACAGAGCTATTGACAATATAAAGGGCCTGCAAGGGTGTCTAAGTACAATA       c.3300
 Y  V  G  D  R  A  I  D  N  I  K  G  L  Q  G  C  L  S  T  I         p.1100

          .         .         .         .         .         .       g.171946
 GAAATCGGAGGCATTTATCTCTCTTACTTTGAAAATGTTCATGGTTTCATTAATAAACCT       c.3360
 E  I  G  G  I  Y  L  S  Y  F  E  N  V  H  G  F  I  N  K  P         p.1120

          .         .         .         .         .         .       g.172006
 CAGGAAGAGCAATTTCTCAAAATCTCTACCAATTCAGTGGTCACTGGCTGTTTGCAGTTA       c.3420
 Q  E  E  Q  F  L  K  I  S  T  N  S  V  V  T  G  C  L  Q  L         p.1140

          .         .         .         .         .         .       g.172066
 AATGTCTGCAACTCCAACCCCTGTTTGCATGGAGGAAACTGTGAAGACATCTATAGCTCT       c.3480
 N  V  C  N  S  N  P  C  L  H  G  G  N  C  E  D  I  Y  S  S         p.1160

          .         .         .         .         .         .       g.172126
 TATCATTGCTCCTGTCCCTTGGGATGGTCAGGGAAACACTGTGAACTCAACATCGATGAA       c.3540
 Y  H  C  S  C  P  L  G  W  S  G  K  H  C  E  L  N  I  D  E         p.1180

          .         .         .         .         .         .       g.172186
 TGCTTTTCAAACCCCTGTATCCATGGCAACTGCTCTGACAGAGTTGCAGCCTACCACTGC       c.3600
 C  F  S  N  P  C  I  H  G  N  C  S  D  R  V  A  A  Y  H  C         p.1200

          .         .         .         .         .         .       g.172246
 ACATGTGAGCCTGGATACACTGGTGTGAACTGTGAAGTGGATATAGACAACTGCCAGAGT       c.3660
 T  C  E  P  G  Y  T  G  V  N  C  E  V  D  I  D  N  C  Q  S         p.1220

          .         .         .         .         .         .       g.172306
 CACCAGTGTGCAAATGGAGCCACCTGCATTAGTCATACTAATGGCTATTCTTGCCTCTGT       c.3720
 H  Q  C  A  N  G  A  T  C  I  S  H  T  N  G  Y  S  C  L  C         p.1240

          .         .          | 10        .         .         .    g.175300
 TTTGGAAATTTTACAGGAAAATTTTGCAG | ACAGAGCAGATTACCCTCAACAGTCTGTGGG    c.3780
 F  G  N  F  T  G  K  F  C  R  |  Q  S  R  L  P  S  T  V  C  G      p.1260

          .         .         .         .         .         .       g.175360
 AATGAGAAGACAAATCTCACTTGCTACAATGGAGGCAACTGCACAGAGTTCCAGACTGAA       c.3840
 N  E  K  T  N  L  T  C  Y  N  G  G  N  C  T  E  F  Q  T  E         p.1280

          .         .         .         | 11         .         .    g.178910
 TTAAAATGTATGTGCCGGCCAGGTTTTACTGGAGAATG | GTGTGAAAAGGACATTGATGAG    c.3900
 L  K  C  M  C  R  P  G  F  T  G  E  W  |  C  E  K  D  I  D  E      p.1300

          .         .         .         .         .         .       g.178970
 TGTGCCTCTGATCCGTGTGTCAATGGAGGTCTGTGCCAGGACTTACTCAACAAATTCCAG       c.3960
 C  A  S  D  P  C  V  N  G  G  L  C  Q  D  L  L  N  K  F  Q         p.1320

          .         .         .         .      | 12  .         .    g.214401
 TGCCTCTGTGATGTTGCCTTTGCTGGCGAGCGCTGCGAGGTGGAC | TTGGCAGATGACTTG    c.4020
 C  L  C  D  V  A  F  A  G  E  R  C  E  V  D   | L  A  D  D  L      p.1340

          .         .         .         .         .         .       g.214461
 ATCTCCGACATTTTCACCACTATTGGCTCAGTGACTGTCGCCTTGTTACTGATCCTCTTG       c.4080
 I  S  D  I  F  T  T  I  G  S  V  T  V  A  L  L  L  I  L  L         p.1360

          .         .         .         .         .         .       g.214521
 CTGGCCATTGTTGCTTCTGTTGTCACCTCCAACAAAAGGGCAACTCAGGGAACCTACAGC       c.4140
 L  A  I  V  A  S  V  V  T  S  N  K  R  A  T  Q  G  T  Y  S         p.1380

          .         .         .         .         .         .       g.214581
 CCCAGCCGTCAGGAGAAGGAGGGCTCCCGAGTGGAAATGTGGAACTTGATGCCACCCCCT       c.4200
 P  S  R  Q  E  K  E  G  S  R  V  E  M  W  N  L  M  P  P  P         p.1400

          .         .                                               g.214602
 GCAATGGAGAGACTGATTTAG                                              c.4221
 A  M  E  R  L  I  X                                                p.1406

          .         .         .         .         .         .       g.214662
 gagcattgtgtcccttcgagatggggatccacacactgtgaatgtgatgactgtacttca       c.*60

          .         .         .         .         .         .       g.214722
 ggtatctctgacatacctgacaatgttaatctgcaactgggattacactggaactacagg       c.*120

          .         .         .         .         .         .       g.214782
 aatgattcctttgaccaccttaaaaactttcacagtggttccgctcgacaccattgtttt       c.*180

          .         .         .         .         .         .       g.214842
 attatattatatcagccaattgcaaaaaaagtctgtgccagtaatttcagccttataatt       c.*240

          .         .         .         .         .         .       g.214902
 agcaaaaacatcttccagagaataaagtcttctgtggctttagtggctatcactgaaact       c.*300

          .         .         .         .         .         .       g.214962
 ctttcctcttttcaacctgggaacaaattttagttttcattttaggtttctgtactttct       c.*360

          .         .         .         .         .         .       g.215022
 gtagtttctgtgtaaactgccatatgtttacatggaaactacaggaaaaaattggctaca       c.*420

          .         .         .         .         .         .       g.215082
 tttctcacttctcctatcatgtggtcaaagttattgttgtataccagcgatgggatgtat       c.*480

          .         .         .         .         .         .       g.215142
 acttttgtccttcattcatggattcagagaaagctctgggaatgacttatggtccaaaaa       c.*540

          .         .         .                                     g.215178
 agtgacccaatggcaacaaataaaaattgaaatgca                               c.*576

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Crumbs homolog 1 (Drosophila) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center