crystallin, alpha B (CRYAB) - coding DNA reference sequence

(used for variant description)

(last modified January 20, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_001885.1 in the CRYAB gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009824.2, covering CRYAB transcript NM_001885.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5025
                                    gacccctcacactcacctagccacc       c.-1

          .         .         .         .         .         .       g.5085
 ATGGACATCGCCATCCACCACCCCTGGATCCGCCGCCCCTTCTTTCCTTTCCACTCCCCC       c.60
 M  D  I  A  I  H  H  P  W  I  R  R  P  F  F  P  F  H  S  P         p.20

          .         .         .         .         .         .       g.5145
 AGCCGCCTCTTTGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGATCTTTTCCCGACG       c.120
 S  R  L  F  D  Q  F  F  G  E  H  L  L  E  S  D  L  F  P  T         p.40

          .         .         .         .         .         .       g.5205
 TCTACTTCCCTGAGTCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGG       c.180
 S  T  S  L  S  P  F  Y  L  R  P  P  S  F  L  R  A  P  S  W         p.60

          .         .  | 02      .         .         .         .    g.6339
 TTTGACACTGGACTCTCAGAG | ATGCGCCTGGAGAAGGACAGGTTCTCTGTCAACCTGGAT    c.240
 F  D  T  G  L  S  E   | M  R  L  E  K  D  R  F  S  V  N  L  D      p.80

          .         .         .         .         .         .       g.6399
 GTGAAGCACTTCTCCCCAGAGGAACTCAAAGTTAAGGTGTTGGGAGATGTGATTGAGGTG       c.300
 V  K  H  F  S  P  E  E  L  K  V  K  V  L  G  D  V  I  E  V         p.100

          .         .     | 03   .         .         .         .    g.7818
 CATGGAAAACATGAAGAGCGCCAG | GATGAACATGGTTTCATCTCCAGGGAGTTCCACAGG    c.360
 H  G  K  H  E  E  R  Q   | D  E  H  G  F  I  S  R  E  F  H  R      p.120

          .         .         .         .         .         .       g.7878
 AAATACCGGATCCCAGCTGATGTAGACCCTCTCACCATTACTTCATCCCTGTCATCTGAT       c.420
 K  Y  R  I  P  A  D  V  D  P  L  T  I  T  S  S  L  S  S  D         p.140

          .         .         .         .         .         .       g.7938
 GGGGTCCTCACTGTGAATGGACCAAGGAAACAGGTCTCTGGCCCTGAGCGCACCATTCCC       c.480
 G  V  L  T  V  N  G  P  R  K  Q  V  S  G  P  E  R  T  I  P         p.160

          .         .         .         .                           g.7986
 ATCACCCGTGAAGAGAAGCCTGCTGTCACCGCAGCCCCCAAGAAATAG                   c.528
 I  T  R  E  E  K  P  A  V  T  A  A  P  K  K  X                     p.175

          .         .         .         .         .         .       g.8046
 atgccctttcttgaattgcattttttaaaacaagaaagtttccccaccagtgaatgaaag       c.*60

          .         .         .         .         .         .       g.8106
 tcttgtgactagtgctgaagcttattaatgctaagggcaggcccaaattatcaagctaat       c.*120

          .                                                         g.8124
 aaaatatcattcagcaac                                                 c.*138

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Crystallin, alpha B protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21
©2004-2019 Leiden University Medical Center