crystallin, beta A4 (CRYBA4) - coding DNA reference sequence

(used for variant description)

(last modified March 7, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_001886.2 in the CRYBA4 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009825.1, covering CRYBA4 transcript NM_001886.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .        | 02.             g.5633
                          acatgttccctgggcctatctcg | gaaggggccaca    c.-1

          .         .         .          | 03        .         .    g.6291
 ATGACCCTGCAATGCACAAAGTCAGCGGGACCCTGGAAG | ATGGTGGTGTGGGATGAGGAC    c.60
 M  T  L  Q  C  T  K  S  A  G  P  W  K   | M  V  V  W  D  E  D      p.20

          .         .         .         .         .         .       g.6351
 GGCTTCCAGGGCCGGCGGCACGAGTTCACGGCCGAGTGCCCCAGCGTGCTGGAGCTTGGC       c.120
 G  F  Q  G  R  R  H  E  F  T  A  E  C  P  S  V  L  E  L  G         p.40

          .         .         .         | 04         .         .    g.8539
 TTCGAGACTGTGCGATCTTTGAAAGTGCTGAGTGGAGC | GTGGGTGGGCTTTGAGCATGCT    c.180
 F  E  T  V  R  S  L  K  V  L  S  G  A  |  W  V  G  F  E  H  A      p.60

          .         .         .         .         .         .       g.8599
 GGCTTCCAAGGGCAGCAGTACATTCTGGAACGAGGCGAATATCCAAGCTGGGATGCCTGG       c.240
 G  F  Q  G  Q  Q  Y  I  L  E  R  G  E  Y  P  S  W  D  A  W         p.80

          .         .         .         .         .         .       g.8659
 GGCGGCAACACGGCCTACCCCGCCGAGAGGCTCACCTCCTTCCGGCCTGCGGCCTGTGCT       c.300
 G  G  N  T  A  Y  P  A  E  R  L  T  S  F  R  P  A  A  C  A         p.100

  | 05       .         .         .         .         .         .    g.11384
  | AACCACCGTGACTCGAGGCTGACAATCTTCGAGCAAGAGAACTTCCTGGGCAAGAAAGGA    c.360
  | N  H  R  D  S  R  L  T  I  F  E  Q  E  N  F  L  G  K  K  G      p.120

          .         .         .         .         .         .       g.11444
 GAGCTGAGCGATGACTATCCTTCCCTCCAGGCCATGGGATGGGAAGGCAATGAAGTAGGG       c.420
 E  L  S  D  D  Y  P  S  L  Q  A  M  G  W  E  G  N  E  V  G         p.140

          .         .    | 06    .         .         .         .    g.13413
 TCCTTCCACGTCCACTCTGGGGC | CTGGGTTTGCTCCCAGTTTCCGGGCTACCGAGGATTT    c.480
 S  F  H  V  H  S  G  A  |  W  V  C  S  Q  F  P  G  Y  R  G  F      p.160

          .         .         .         .         .         .       g.13473
 CAGTATGTGCTGGAATGCGATCACCATTCCGGTGACTACAAACATTTCCGGGAGTGGGGC       c.540
 Q  Y  V  L  E  C  D  H  H  S  G  D  Y  K  H  F  R  E  W  G         p.180

          .         .         .         .         .                 g.13524
 TCTCATGCCCCGACCTTCCAGGTGCAGAGCATCCGCAGGATCCAGCAGTGA                c.591
 S  H  A  P  T  F  Q  V  Q  S  I  R  R  I  Q  Q  X                  p.196

          .         .         .         .         .         .       g.13584
 acaggggtgcggcacggaggagcgcatgcgtgcttatctgcaatggaggcgctctggagg       c.*60

          .         .         .         .         .         .       g.13644
 ctgtggtgtgttctctccttctgcctccccctgtaacctgtgtgaacccagcacccatgt       c.*120

          .         .         .         .         .         .       g.13704
 gaactggtccgtgcacagtcagcacaaaaaactcaaacgaataaaaaagagaaagtctgg       c.*180

                                                                    g.13709
 tatta                                                              c.*185

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Crystallin, beta A4 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center