crystallin, beta A4 (CRYBA4) - 2128 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6449
gtgagtctagggggacactgagttggggtagagggtggacaggaagggacctagagacgg  c.158+60

         .         .         .         .         .         .  g.6509
gtgctaggacttttagatattctaggtcccctctccctaggctcttactgttgtgccctc  c.158+120

         .         .         .         .         .         .  g.6569
ctgaagtactgaggagtgtgcaggactgccatgtaagattatgcaggttgcgcactgccc  c.158+180

         .         .         .         .         .         .  g.6629
aacagtaggagggtgccatttacacagaccctgcccactggatgaggcagttctgcagga  c.158+240

         .         .         .         .         .         .  g.6689
gatccttagaatccagtgttggatctaaaaatgtccctcccagccgtaaattgaaagcca  c.158+300

         .         .         .         .         .         .  g.6749
acatcacccgcctaaagtagaaggtaactgtaaaaataaacataatgttttaatgctatt  c.158+360

         .         .         .         .         .         .  g.6809
aatttttagctaaatagtcttgctgctaagcatgtggcctgatcattttttgtaaaaaaa  c.158+420

         .         .         .         .         .         .  g.6869
aaaaaaattaaaaaacaaaaaagagagtgagagagagagattagtgagacacagagaggt  c.158+480

         .         .         .         .         .         .  g.6929
gttaaggacacactaataacacaccaagactttctagaccagtgtcattcagtggacctg  c.158+540

         .         .         .         .         .         .  g.6989
tctgcaatgatggagatgttctacatctacaccatccatttcagagccactggccagatg  c.158+600

         .         .         .         .         .         .  g.7049
tgaccattgaggatttgaaaggtagccagcatgagtagagaactgaatcttgtttaatct  c.158+660

         .         .         .         .         .         .  g.7109
taatttatttaagtttaaatttaattagctacatatggccagtggctaccatattagata  c.158+720

         .         .         .         .         .         .  g.7169
gaaggttctagaaggttggaaagcaggtagaaaggagatgtggccagtagctaccatatt  c.158+780

         .         .         .         .         .         .  g.7229
ggatagaaggctctagaagtttggaaagtagttggaaagatgtggccagtagctaccata  c.158+840

         .         .         .         .         .         .  g.7289
ttggatagaagtttctagaaggcaggaaagtaaatagaaaggaggtgtggccagtagcta  c.158+900

         .         .         .         .         .         .  g.7349
ccatactggataaaagttctagaagtttggaaagtagatcgaaaggagatgtggccagta  c.158+960

         .         .         .         .         .         .  g.7409
gcttccatattggatagaaggttctagaaggttggaaagtagctagaaaggcaatgtggc  c.158+1020

         .         .         .         .      g.7453
cagtagctaccatattggatagaaggttctagaaagttggaaag  c.158+1064

--------------------- middle of intron ---------------------
    g.7454          .         .         .         .           g.7497
    c.159-1064  tagatagacaggagatgtggccagtagctaccatattggataga  c.159-1021

.         .         .         .         .         .           g.7557
aggttgtagaagtttggaaagtagataggagatttggagtcacttaatgctacacctgtg  c.159-961

.         .         .         .         .         .           g.7617
agtgccacctgaggtcatcttgggtgatttttgcacatctcatgctttagtaaatactct  c.159-901

.         .         .         .         .         .           g.7677
tttagcttctgatttgtgcaggtggggaatgggggtcagatgggaacagaggctttctag  c.159-841

.         .         .         .         .         .           g.7737
gggtatgtccagcaggctgacagactcagccagtaagcagacaatgagcttggatagatt  c.159-781

.         .         .         .         .         .           g.7797
cagacagtttattacttatacagacagtaaaggcaaggtgcagcctcctgtgtcccttgt  c.159-721

.         .         .         .         .         .           g.7857
cctactggacgacaccaaaacaaagggggctgaatgacaggcattaggaatggtaggaac  c.159-661

.         .         .         .         .         .           g.7917
cccgtggctgaagagctgcttccatgcttcaacgatagcttgctgctgtcgcctgtgggg  c.159-601

.         .         .         .         .         .           g.7977
aggcgaggtggaaagccccacatctcagagtggccagagaggcagatgaggggctgcctc  c.159-541

.         .         .         .         .         .           g.8037
gtggcagcctcccacaagagagggaggaaaatgagagatggccatgcggtcgctccttgc  c.159-481

.         .         .         .         .         .           g.8097
aagactgcccgtctcccacaccctggcaggatcacggggaattccaccaaggtgagatca  c.159-421

.         .         .         .         .         .           g.8157
gtctgtgatcagctttgcctccttggcctctgtggacacggacggaggagcaaggttgtc  c.159-361

.         .         .         .         .         .           g.8217
agggcacctgtgtgaagcagtttccctacctatgggacacacagcaagtgaggtctagag  c.159-301

.         .         .         .         .         .           g.8277
ctgggttcctcaactctggcgctactgatgtttcgggctggatcatcctttgcagggaag  c.159-241

.         .         .         .         .         .           g.8337
gctggcctgtgcattatgggatgtttagtggtatccctggcctctacccgatagatggcc  c.159-181

.         .         .         .         .         .           g.8397
ttcgcagtccctcccctagtcgtgacaaccaaaaatgtctccagccatcgtcaagtgttt  c.159-121

.         .         .         .         .         .           g.8457
cctgggggcacagtcacccctgaatggttgtgactgtgaccgttctagacccaattgctg  c.159-61

.         .         .         .         .         .           g.8517
gtctagaatgcagggtgagggggacgcttacctcctgcacactctaccctctgtctgcag  c.159-1


Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center