crystallin, beta A4 (CRYBA4) - 2665 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.8719
gtaagttctaccactgctgcatcccggggaggcccaagcccctcatgtgggcacttcgga  c.300+60

         .         .         .         .         .         .  g.8779
atcaaaggttccagagttgaaattctcatgtcgccacttcaagctgtgtgacaagggctg  c.300+120

         .         .         .         .         .         .  g.8839
ttcagtctctttcctctccaagcctcggtttcttcatcttgaaatggggcaatagtacca  c.300+180

         .         .         .         .         .         .  g.8899
atgttcttgggaagaagaacgtataacatctgaccagagcctgccttaaactctctgctc  c.300+240

         .         .         .         .         .         .  g.8959
acagcaaccctggttgtgataggagcccctgccagttttgtgcccttttttttttgtgat  c.300+300

         .         .         .         .         .         .  g.9019
tcagggaccctgagagaatctgggtaccagggatggtagggccaagtggagaggaaaggt  c.300+360

         .         .         .         .         .         .  g.9079
ttcatttcttgctcctaattcagcatcagtgctcctgatcttacattttactgctgtttt  c.300+420

         .         .         .         .         .         .  g.9139
tggagtgtgggtggaggtgggcattattattcccatctcaccaatgaaaacattgaggct  c.300+480

         .         .         .         .         .         .  g.9199
cagaaaggtgtattttaggctgggcatggtggctcacacctgtaatcccagcactttggg  c.300+540

         .         .         .         .         .         .  g.9259
aggccaaggcgggtagatcacttgaggccaggagttcaagatcagcttggccaacatggt  c.300+600

         .         .         .         .         .         .  g.9319
gaaaccctgtctctactgaaaatacaaaaaaattagttgagtgtggtggcacatgcctgt  c.300+660

         .         .         .         .         .         .  g.9379
agtcccagctactcaggaggctgaggcaggagaatcacttgaacccgggagacagaggtt  c.300+720

         .         .         .         .         .         .  g.9439
gcagtgagccaagatcgcaccactgcattccagcctgggcgccagagcaagactctgtct  c.300+780

         .         .         .         .         .         .  g.9499
caaaacaaaacaaaacaaaaaaacaaaaacaaacaaacaaacacaaaaacaacaaagtgt  c.300+840

         .         .         .         .         .         .  g.9559
gttttatttttcaattcttattgatttaaaatgacataagtcaccatatttaccatccaa  c.300+900

         .         .         .         .         .         .  g.9619
aattctgaaggaaaatcctgctatggtcagggttgagtatcccttacctgaaatgcttgg  c.300+960

         .         .         .         .         .         .  g.9679
gaccagaagtgttttggattttgaatattttccccagattttgcaatatttgtaatactt  c.300+1020

         .         .         .         .         .         .  g.9739
acagttgagcagcctgaatccaaaaatccaaaatctgaaatactgcagtgagcattcttt  c.300+1080

         .         .         .         .         .         .  g.9799
gagtgtcatgtcgtcactcaaaaagttttagattttggagcattttggatttcggatttt  c.300+1140

         .         .         .         .         .         .  g.9859
taggttagggatgttcaacctatacatttgtgtctctatgtatatacacatccaaatcaa  c.300+1200

         .         .         .         .         .         .  g.9919
catctacatctatatctgtataatctatatatcttatctatattgcacacataattttgt  c.300+1260

         .         .         .         .         .         .  g.9979
cataaaattggaatcataatgaatctaaggcttggaaactagcttttctcactgagcaaa  c.300+1320

         .     g.9992
tgtgtcgcaatca  c.300+1333

--------------------- middle of intron ---------------------
                                    g.9993        .           g.10004
                                    c.301-1332  tcagtccaggtg  c.301-1321

.         .         .         .         .         .           g.10064
attaaatctcacttccatcgtttttcatagctccctagtattctgttttgtgaataagtc  c.301-1261

.         .         .         .         .         .           g.10124
catttgttcatttattctgcaaacagtctagatattgtgctaatatagggacccgtggcg  c.301-1201

.         .         .         .         .         .           g.10184
ggctgcaacagaaacaatccctcattcccagcagtttgcaactcctgatttcatttagtc  c.301-1141

.         .         .         .         .         .           g.10244
ctcaaaagaaccctgaaaaatgggtagggttagtttcattttatagatacaggaacagag  c.301-1081

.         .         .         .         .         .           g.10304
gctcagaaatcctgtctaacctcagtcagttggtaagtggcagctgcctcctagcaggaa  c.301-1021

.         .         .         .         .         .           g.10364
ggatttgagatgatatctctacacctcctttctttccttcttttttcttttcttttcttt  c.301-961

.         .         .         .         .         .           g.10424
tcctttcccctccctccctccctccctccctcctttctttctttctttctttctttcttt  c.301-901

.         .         .         .         .         .           g.10484
ctttctttctttctttctttctttctttctttctttctttttctttctttctttctttcc  c.301-841

.         .         .         .         .         .           g.10544
ttctttctttttctttctttctttctttctctttctttccttttctttctttctttcttt  c.301-781

.         .         .         .         .         .           g.10604
ctttctttctttctttctctttctttccttttctttctttctttccttctttcattctct  c.301-721

.         .         .         .         .         .           g.10664
gtctttctttttctttctttttctctttctttctttctctttctctctctctccttcctt  c.301-661

.         .         .         .         .         .           g.10724
ccttccttctctctctctctttctttctttctttcttttgatggagtttttgcttttgtt  c.301-601

.         .         .         .         .         .           g.10784
gtccaggctggagtgcaatgccacaatctcggctcactgcaacctctgcctcccaggttc  c.301-541

.         .         .         .         .         .           g.10844
aagcgattctcctgcctcagtctcccaagtagctgagattacaggcatgtgccaccacgc  c.301-481

.         .         .         .         .         .           g.10904
ttggctaattttttgtatttagtagagacagggtttcaccatgttcgtcgggctggtctt  c.301-421

.         .         .         .         .         .           g.10964
gaactcctgacctcaggtgatccaccctcctcggcctcccaaaatgctgggattataggc  c.301-361

.         .         .         .         .         .           g.11024
gtgagccaccgcgccgggcctctacaccctttttcttaaccacagtgtaatgcctcagct  c.301-301

.         .         .         .         .         .           g.11084
taccactggatccccaattttggacataaaagttgactcctttttttgtttgtttgtttt  c.301-241

.         .         .         .         .         .           g.11144
tgaaaaaactgttatgatgaacattcttgcagcctatttattccatgattattttctttg  c.301-181

.         .         .         .         .         .           g.11204
tggaaatttctggaagggcaaatggcaaggtttctggtacctgttgccttattgcccttc  c.301-121

.         .         .         .         .         .           g.11264
caaaaggtttgcaaggaaggctgatttgggagacaagggcagggagtgtggaggccagga  c.301-61

.         .         .         .         .         .           g.11324
gaggctcctgggtttccaactgggagcctgctggtctgactgtgttccctgttcctgtag  c.301-1


Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center