crystallin, beta B1 (CRYBB1) - coding DNA reference sequence

(used for variant description)

(last modified March 7, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_001887.3 in the CRYBB1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009826.1, covering CRYBB1 transcript NM_001887.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .                g.5010
                                                   atagcacctg       c.-61

 .         .         .         .         . | 02       .             g.6708
 cccgcctgcctgtcctccagcaggaagtagcaagtccccag | acttttgcaggcgggaacc    c.-1

          .         .         .         .         .         .       g.6768
 ATGTCTCAGGCTGCAAAGGCCTCGGCCTCGGCCACAGTGGCGGTGAACCCAGGGCCTGAC       c.60
 M  S  Q  A  A  K  A  S  A  S  A  T  V  A  V  N  P  G  P  D         p.20

          .         .         .         .         .         .       g.6828
 ACCAAGGGGAAGGGGGCCCCACCTGCAGGAACATCCCCTAGTCCCGGCACTACCCTGGCC       c.120
 T  K  G  K  G  A  P  P  A  G  T  S  P  S  P  G  T  T  L  A         p.40

          .         .         .         .         .         .       g.6888
 CCAACAACCGTGCCTATTACCAGCGCCAAGGCGGCGGAACTGCCTCCTGGGAACTACAGG       c.180
 P  T  T  V  P  I  T  S  A  K  A  A  E  L  P  P  G  N  Y  R         p.60

  | 03       .         .         .         .         .         .    g.10897
  | CTGGTGGTCTTCGAACTGGAAAACTTCCAGGGCCGTCGAGCAGAATTCTCGGGGGAGTGC    c.240
  | L  V  V  F  E  L  E  N  F  Q  G  R  R  A  E  F  S  G  E  C      p.80

          .         .         .         .         .          | 04    g.15007
 TCAAATCTGGCAGACCGTGGCTTCGACCGTGTGCGCAGCATCATTGTCTCCGCGGGACC | C    c.300
 S  N  L  A  D  R  G  F  D  R  V  R  S  I  I  V  S  A  G  P  |      p.100

          .         .         .         .         .         .       g.15067
 TGGGTCGCCTTTGAGCAGTCCAACTTCCGCGGGGAGATGTTCATCCTGGAGAAGGGCGAG       c.360
 W  V  A  F  E  Q  S  N  F  R  G  E  M  F  I  L  E  K  G  E         p.120

          .         .         .         .         .         .       g.15127
 TACCCTCGCTGGAACACATGGTCGAGCAGCTACCGCAGTGATCGGCTCATGTCCTTCCGG       c.420
 Y  P  R  W  N  T  W  S  S  S  Y  R  S  D  R  L  M  S  F  R         p.140

          .   | 05     .         .         .         .         .    g.21054
 CCCATCAAAATG | GATGCCCAGGAGCACAAAATCTCCCTGTTTGAAGGGGCCAACTTCAAG    c.480
 P  I  K  M   | D  A  Q  E  H  K  I  S  L  F  E  G  A  N  F  K      p.160

          .         .         .         .         .         .       g.21114
 GGCAACACCATAGAGATCCAGGGGGACGACGCACCCAGTCTCTGGGTCTACGGCTTCAGT       c.540
 G  N  T  I  E  I  Q  G  D  D  A  P  S  L  W  V  Y  G  F  S         p.180

          .         .         .      | 06  .         .         .    g.23379
 GACCGCGTGGGCAGCGTGAAGGTCTCCAGTGGAAC | ATGGGTTGGCTATCAGTATCCTGGC    c.600
 D  R  V  G  S  V  K  V  S  S  G  T  |  W  V  G  Y  Q  Y  P  G      p.200

          .         .         .         .         .         .       g.23439
 TACCGCGGGTACCAGTACCTCCTAGAGCCTGGTGACTTCCGGCACTGGAATGAGTGGGGA       c.660
 Y  R  G  Y  Q  Y  L  L  E  P  G  D  F  R  H  W  N  E  W  G         p.220

          .         .         .         .         .         .       g.23499
 GCCTTCCAGCCACAGATGCAGTCCCTGCGTCGCCTGCGTGACAAGCAGTGGCACCTCGAG       c.720
 A  F  Q  P  Q  M  Q  S  L  R  R  L  R  D  K  Q  W  H  L  E         p.240

          .         .         .                                     g.23538
 GGGTCCTTCCCTGTCCTGGCCACAGAGCCCCCCAAGTGA                            c.759
 G  S  F  P  V  L  A  T  E  P  P  K  X                              p.252

          .         .         .         .         .         .       g.23598
 gtccacacctcactctgctaccttgccccaacccttcttcatgttcaattatttccccca       c.*60

          .         .         .                                     g.23630
 tttttcccaggcaaataaaattccctaaagcc                                   c.*92

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Crystallin, beta B1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center