crystallin, gamma S (CRYGS) - coding DNA reference sequence

(used for variant description)

(last modified March 7, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_017541.2 in the CRYGS gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_009829.1, covering CRYGS transcript NM_017541.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5052
         agccattcctgaatttctttcagcactgggaaaaccagtctatgcaccaaaa       c.-1

          .         .  | 02      .         .         .         .    g.9820
 ATGTCTAAAACTGGAACCAAG | ATTACTTTCTATGAAGACAAAAATTTTCAAGGCCGTCGC    c.60
 M  S  K  T  G  T  K   | I  T  F  Y  E  D  K  N  F  Q  G  R  R      p.20

          .         .         .         .         .         .       g.9880
 TATGACTGTGATTGCGACTGTGCAGATTTCCACACATACCTAAGTCGCTGCAACTCCATT       c.120
 Y  D  C  D  C  D  C  A  D  F  H  T  Y  L  S  R  C  N  S  I         p.40

          .         .         .         .         .         .       g.9940
 AAAGTGGAAGGAGGCACCTGGGCTGTTTATGAAAGGCCCAACTTTGCTGGGTACATGTAC       c.180
 K  V  E  G  G  T  W  A  V  Y  E  R  P  N  F  A  G  Y  M  Y         p.60

          .         .         .         .         .         .       g.10000
 ATCTTACCACAGGGAGAGTACCCTGAATACCAGCGTTGGATGGGCCTCAACGACCGCCTC       c.240
 I  L  P  Q  G  E  Y  P  E  Y  Q  R  W  M  G  L  N  D  R  L         p.80

          .         .     | 03   .         .         .         .    g.10446
 AGCTCCTGCAGAGCTGTTCATCTG | CCTAGTGGAGGCCAGTATAAGATTCAGATCTTTGAG    c.300
 S  S  C  R  A  V  H  L   | P  S  G  G  Q  Y  K  I  Q  I  F  E      p.100

          .         .         .         .         .         .       g.10506
 AAAGGGGATTTTAGTGGTCAGATGTATGAAACCACCGAAGATTGCCCTTCCATCATGGAG       c.360
 K  G  D  F  S  G  Q  M  Y  E  T  T  E  D  C  P  S  I  M  E         p.120

          .         .         .         .         .         .       g.10566
 CAATTTCACATGCGAGAGATCCACTCCTGTAAGGTGCTGGAGGGTGTCTGGATTTTCTAT       c.420
 Q  F  H  M  R  E  I  H  S  C  K  V  L  E  G  V  W  I  F  Y         p.140

          .         .         .         .         .         .       g.10626
 GAGCTACCCAACTACCGTGGCAGGCAGTACCTCCTGGACAAGAAGGAGTACCGGAAGCCC       c.480
 E  L  P  N  Y  R  G  R  Q  Y  L  L  D  K  K  E  Y  R  K  P         p.160

          .         .         .         .         .                 g.10683
 ATCGATTGGGGTGCAGCCTCCCCAGCTGTCCAGTCTTTCCGCCGCATTGTGGAGTAA          c.537
 I  D  W  G  A  A  S  P  A  V  Q  S  F  R  R  I  V  E  X            p.178

          .         .         .         .         .         .       g.10743
 tgacatgaatggggccatattcttcctggggcccaaatgctggctggccttgtggtccaa       c.*60

          .         .         .         .         .         .       g.10803
 ataggcatcatcaataaaacagttggcatgcatcccactgctgactataatgcctctcct       c.*120

          .         .         .         .         .         .       g.10863
 taaatgcttctagggaccagcaatacagtgctcgccacagtgggcagtcacacaaagcta       c.*180

          .         .         .         .         .         .       g.10923
 cccatctgccagatcaccaatctagatctttgtgccaaacaaaatgagatctcattaaaa       c.*240

          .                                                         g.10936
 ggttagaaagtca                                                      c.*253

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Crystallin, gamma S protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center