crystallin, mu (CRYM) - coding DNA reference sequence

(used for variant description)

(last modified March 7, 2015)


This file was created to facilitate the description of sequence variants on transcript NM_001888.3 in the CRYM gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011610.1, covering CRYM transcript NM_001888.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5058
   tttcaaatggggagtttccctgcacaagctttcttgtctgccactatgtgagatatac       c.-241

 .         .         .         .         .        | 02.             g.29135
 ctttcaccttctgccgtgattgtgaggcctcctcagccacgtggaact | gtaaaaactcct    c.-181

 .         .         .         .         .         .                g.29195
 ggaagaaaagatcctgcaatttggctttttgtgagatggaaaagattacaccttgccctg       c.-121

 .         .         .         .     | 03   .         .             g.29772
 caaacttcccccctttaaaggcgaaggtttgttag | agcagcgggcgcgctcataaagggc    c.-61

 .         .         .         .         .         .                g.29832
 acagccgagggtacgtggatcgcggtgcggagactgaggttagaaggcacaggtggcgag       c.-1

          .         .         .         .         .         .       g.29892
 ATGAGCCGGGTACCAGCGTTCCTGAGCGCGGCCGAGGTGGAGGAACACCTCCGCAGCTCC       c.60
 M  S  R  V  P  A  F  L  S  A  A  E  V  E  E  H  L  R  S  S         p.20

          .         .         .         .         .         .       g.29952
 AGCCTCCTCATCCCGCCTCTAGAGACGGCCCTGGCCAACTTCTCCAGCGGTCCCGAAGGA       c.120
 S  L  L  I  P  P  L  E  T  A  L  A  N  F  S  S  G  P  E  G         p.40

          .         .         .         .         . | 04       .    g.30509
 GGGGTCATGCAGCCCGTGCGCACCGTGGTGCCGGTGACCAAGCACAGGGG | CTACCTGGGG    c.180
 G  V  M  Q  P  V  R  T  V  V  P  V  T  K  H  R  G  |  Y  L  G      p.60

          .         .         .         .         .         .       g.30569
 GTCATGCCCGCCTACAGTGCTGCAGAGGATGCACTGACCACCAAGTTGGTCACCTTCTAC       c.240
 V  M  P  A  Y  S  A  A  E  D  A  L  T  T  K  L  V  T  F  Y         p.80

          .         .         .         .         .         .       g.30629
 GAGGACCGCGGCATCACCTCGGTCGTCCCTTCCCACCAGGCTACTGTGCTACTCTTTGAG       c.300
 E  D  R  G  I  T  S  V  V  P  S  H  Q  A  T  V  L  L  F  E         p.100

          .         .     | 05   .         .         .         .    g.32525
 CCCAGCAATGGCACCCTGCTGGCG | GTCATGGATGGAAATGTCATAACTGCAAAGAGAACA    c.360
 P  S  N  G  T  L  L  A   | V  M  D  G  N  V  I  T  A  K  R  T      p.120

          .         .        | 06.         .         .         .    g.38225
 GCTGCAGTTTCTGCCATTGCCACCAAG | TTTCTGAAACCTCCCAGCAGTGAAGTGCTGTGC    c.420
 A  A  V  S  A  I  A  T  K   | F  L  K  P  P  S  S  E  V  L  C      p.140

          .         .         .         .         .         .       g.38285
 ATCCTTGGGGCTGGGGTCCAGGCCTACAGCCATTATGAGATCTTCACAGAGCAGTTCTCC       c.480
 I  L  G  A  G  V  Q  A  Y  S  H  Y  E  I  F  T  E  Q  F  S         p.160

           | 07        .         .         .         .         .    g.40397
 TTTAAGGAG | GTGAGGATATGGAACCGCACCAAAGAAAATGCAGAGAAGTTTGCAGACACA    c.540
 F  K  E   | V  R  I  W  N  R  T  K  E  N  A  E  K  F  A  D  T      p.180

          .         .         .         .         .         .       g.40457
 GTGCAAGGAGAGGTACGGGTCTGTTCTTCGGTCCAGGAGGCTGTGGCAGGTGCAGATGTG       c.600
 V  Q  G  E  V  R  V  C  S  S  V  Q  E  A  V  A  G  A  D  V         p.200

          .         .         .         .         .         .       g.40517
 ATCATCACAGTCACCCTGGCAACAGAGCCCATTTTGTTTGGTGAATGGGTGAAGCCAGGG       c.660
 I  I  T  V  T  L  A  T  E  P  I  L  F  G  E  W  V  K  P  G         p.220

          .    | 08    .         .         .         .         .    g.45972
 GCTCACATCAATG | CTGTTGGAGCCAGCAGACCTGACTGGAGAGAACTGGATGATGAGCTC    c.720
 A  H  I  N  A |   V  G  A  S  R  P  D  W  R  E  L  D  D  E  L      p.240

          .         .         .         .         .         .       g.46032
 ATGAAAGAAGCTGTGCTGTACGTGGATTCCCAGGAGGCTGCCCTGAAGGAGTCTGGAGAT       c.780
 M  K  E  A  V  L  Y  V  D  S  Q  E  A  A  L  K  E  S  G  D         p.260

          .      | 09  .         .         .         .         .    g.46790
 GTCCTGCTGTCAGGG | GCCGAGATCTTTGCTGAGCTGGGAGAAGTGATTAAGGGAGTGAAA    c.840
 V  L  L  S  G   | A  E  I  F  A  E  L  G  E  V  I  K  G  V  K      p.280

          .         .         .         . | 10       .         .    g.49258
 CCAGCCCACTGTGAGAAGACCACCGTGTTCAAGTCTTTGG | GAATGGCAGTGGAAGACACA    c.900
 P  A  H  C  E  K  T  T  V  F  K  S  L  G |   M  A  V  E  D  T      p.300

          .         .         .         .                           g.49303
 GTTGCAGCCAAACTCATCTATGATTCCTGGTCATCTGGTAAATAA                      c.945
 V  A  A  K  L  I  Y  D  S  W  S  S  G  K  X                        p.314

          .         .         .         .         .         .       g.49363
 aacaaaggaacttgatgttgagatggatgcttgaggaatattgctgctggttctcataat       c.*60

          .         .         .         .         .         .       g.49423
 ttctagagtaaatgagggagtccagtccccagtgaactctccttttgtgcttatcatgtt       c.*120

          .         .         .         .         .         .       g.49483
 ttaccttaaatgctgagatcctcatttatgtttgtagttggaaagcaaagctaggtagcc       c.*180

          .         .         .         .         .         .       g.49543
 atttcttctgttctaccaagttataatagcattcatttccctttatatttccctgaaata       c.*240

          .         .                                               g.49566
 aagcacattccaattgtgcagtg                                            c.*263

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Crystallin, mu protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 12
©2004-2015 Leiden University Medical Center