cysteine and glycine-rich protein 3 (cardiac LIM protein) (CSRP3) - coding DNA reference sequence

(used for variant description)

(last modified June 11, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_003476.4 in the CSRP3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011932.2, covering CSRP3 transcript NM_003476.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5059
  agtgagccgagatcgcgccactacactccagactgggcgacagagccagactccgtctc       c.-181

 .         .         .         .         .         .                g.5119
 aaaaaaaaaaaaaaaaaaagagagagagcaccttaggaatcatctgcctcacacgaatat       c.-121

 .   | 02     .         .         .         .         .             g.13586
 tct | caggccaaggctggtgacagccttcatatatttaaagaggacaagagcccctcagac    c.-61

 .         .         .         .  | 03      .         .             g.23123
 tcagttgagctgaacggagtccacacaggcag | acttgaccttgaccagatagtcttcaag    c.-1

          .         .         .         .         .         .       g.23183
 ATGCCAAACTGGGGCGGAGGCGCAAAATGTGGAGCCTGTGAAAAGACCGTCTACCATGCA       c.60
 M  P  N  W  G  G  G  A  K  C  G  A  C  E  K  T  V  Y  H  A         p.20

          .         .         .         .         .   | 04     .    g.27275
 GAAGAAATCCAGTGCAATGGAAGGAGTTTCCACAAGACGTGTTTCCACTGCA | TGGCCTGC    c.120
 E  E  I  Q  C  N  G  R  S  F  H  K  T  C  F  H  C  M |   A  C      p.40

          .         .         .         .         .         .       g.27335
 AGGAAGGCTCTTGACAGCACGACAGTCGCGGCTCATGAGTCGGAGATCTACTGCAAGGTG       c.180
 R  K  A  L  D  S  T  T  V  A  A  H  E  S  E  I  Y  C  K  V         p.60

          .         .         .         .         .         .       g.27395
 TGCTATGGGCGCAGATATGGCCCCAAAGGGATCGGGTATGGACAAGGCGCTGGCTGTCTC       c.240
 C  Y  G  R  R  Y  G  P  K  G  I  G  Y  G  Q  G  A  G  C  L         p.80

          .         .         .         .  | 05      .         .    g.29242
 AGCACAGACACGGGCGAGCATCTCGGCCTGCAGTTCCAACA | GTCCCCAAAGCCGGCACGC    c.300
 S  T  D  T  G  E  H  L  G  L  Q  F  Q  Q  |  S  P  K  P  A  R      p.100

          .         .         .         .         .         .       g.29302
 TCAGTTACCACCAGCAACCCTTCCAAATTCACTGCGAAGTTTGGAGAGTCCGAGAAGTGC       c.360
 S  V  T  T  S  N  P  S  K  F  T  A  K  F  G  E  S  E  K  C         p.120

          .         .         .         .         .     | 06   .    g.30532
 CCTCGATGTGGCAAGTCAGTCTATGCTGCTGAGAAGGTTATGGGAGGTGGCAAG | CCTTGG    c.420
 P  R  C  G  K  S  V  Y  A  A  E  K  V  M  G  G  G  K   | P  W      p.140

          .         .         .         .         .         .       g.30592
 CACAAGACCTGTTTCCGCTGTGCCATCTGTGGGAAGAGTCTGGAGTCCACAAATGTCACT       c.480
 H  K  T  C  F  R  C  A  I  C  G  K  S  L  E  S  T  N  V  T         p.160

          .         .         | 07         .         .         .    g.32857
 GACAAAGATGGGGAACTTTATTGCAAAG | TTTGCTATGCCAAAAATTTTGGCCCCACGGGT    c.540
 D  K  D  G  E  L  Y  C  K  V |   C  Y  A  K  N  F  G  P  T  G      p.180

          .         .         .         .                           g.32902
 ATTGGGTTTGGAGGCCTTACACAACAAGTGGAAAAGAAAGAATGA                      c.585
 I  G  F  G  G  L  T  Q  Q  V  E  K  K  E  X                        p.194

          .         .         .         .         .         .       g.32962
 agaggtgcgccgtttctcagattttttgcgagcctaaaacacttgccaagtaatcctgca       c.*60

          .         .         .         .         .         .       g.33022
 cagatcgatacctttccccaaatagcctctcctttgtagtcgtacattatgtgtttctcc       c.*120

          .         .         .         .         .         .       g.33082
 tcagaagtgatcaggtctttactgaatgttagaagaggcctttggaagaaaattatgtaa       c.*180

          .         .         .         .         .         .       g.33142
 agtttaatctataacaaatgctttattatttataatgcttggaatgggagaggcaataaa       c.*240

          .         .         .         .         .         .       g.33202
 taaatgttttagtgctatcttgtatggctctagatcttttctttgagatagaaattttca       c.*300

          .         .         .         .         .         .       g.33262
 aaaacataaagctagttcaaaaaacgagttgcagagcatataataaatttggatgtcaac       c.*360

          .         .         .         .         .         .       g.33322
 tgagaaaggagtgagaaggaagaaacaatgcgcaaaggaaagcagtctttcagaatctgt       c.*420

          .         .         .         .         .         .       g.33382
 cagccaagtgtctttctagttactgctaatggagaagaaaacagggggtctgggagaaaa       c.*480

          .         .         .         .         .         .       g.33442
 tagagaacatgatagcaaaatctaaaaggaaaatcaaaactaataaaattgctgaagagt       c.*540

          .         .         .         .         .         .       g.33502
 tgatccctttgtcctatcgtggggctttgtaatgttacacatctcgtgaaaactcagaaa       c.*600

          .         .         .         .                           g.33542
 tgacaataaagcgtggcatttgcctctgtattataaatga                           c.*640

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Cysteine and glycine-rich protein 3 (cardiac LIM protein) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.