D-2-hydroxyglutarate dehydrogenase (D2HGDH) - downstream reference sequence


            .         .         .         .         .         . g.39255
aaccttc / tctttgcttctgttactggaaaatcatctttcagagcccattgtgaagggcct c.*900

         .         .         .         .         .         .    g.39315
gtgcatcccattcccacagcccctggaccactggggccatagtgtggccgggcctgacac    c.*960

         .         .         .         .         .         .    g.39375
tactgtgactgtcactgtgcctcctgtccccatgcactgtctggtggcagctgagctccc    c.*1020

         .         .         .         .         .         .    g.39435
accggctgcacagggcaggcctggacatggaacgggcaactcataacccttggtggccct    c.*1080

         .         .         .         .         .         .    g.39495
ggaggccctcagcagctgggcctgaccgaggtgtatccacgggcccctcctgtccctgtg    c.*1140

         .         .         .         .         .         .    g.39555
ggtgtcgaggacctcggatcctgctcagagggggaaacatacctctgacccgctgccctg    c.*1200

         .         .         .         .         .         .    g.39615
cagagcccgcctgcctagccagggcctctgtgtggacaggccacgtcctcctggtggagg    c.*1260

         .         .         .         .         .         .    g.39675
tcctcgggggatgggtgggggccttggtccagcatgattttttttttttgagacaggatc    c.*1320

         .         .         .         .         .         .    g.39735
tcactctgtcacccaggctggagtgcaggggtatagtcacagctcagtgcagcctccacc    c.*1380

         .         .         .         .         .         .    g.39795
tcctgggctcaagtgatcctcccacctcagcctcctgagtagctgggagtacaggtgtga    c.*1440

         .         .         .         .         .         .    g.39855
gccatcatgcccagataatttttttttttttttttgagacagagtcttgttctgtcaccc    c.*1500

         .         .         .         .         .         .    g.39915
aggctggagtgcagtggtgcgatcttggctcactgcaagttccgcctcccgggttcacgc    c.*1560

         .         .         .         .         .         .    g.39975
cattctccttcctcagcctcccgagtaactgggactacaggtgtccaccaccgtgcccgg    c.*1620

         .         .         .         .         .         .    g.40035
ctaattttttgtatttttagtagagatggggtttcaccttcttagccaggatggtcttga    c.*1680

         .         .         .         .         .         .    g.40095
tctcctgacctcatgatctgcccgcctcggcctcccaaagtgctgggatcacaggcatga    c.*1740

         .         .         .         .         .         .    g.40155
gccaccgcacccggccatgcccagataatttttaaatttttttttttgtagagatgaggt    c.*1800

         .         .         .         .         .         .    g.40215
gtccctgtgttgcccaggctggtcttgaactcctggcctccagcggcctcccacctcagc    c.*1860

         .         .         .         .         .         .    g.40275
ctcccaaagtgctgggattacaggcccgagcctctgcgtccagccgatccagcatgcttt    c.*1920

         .         .         .         .         .         .    g.40335
gaaggcacaaatcaggggcactttcatgctggcccagcagagccagtgggtcccgcccaa    c.*1980

         .         .         .         .         .         .    g.40395
tgcctgggctacttcctgctgtgcctgggggcacctggggctgtcctgcctcactggcca    c.*2040

         .         .         .         .         .         .    g.40455
aggcccggctctgtccctgggctctggccactgttctgccatcccaggctgggtacccat    c.*2100

         .         .         .         .         .         .    g.40515
gggcagcccgacagtatctgttgcacagagcagaccccaggccccatgggtgcctgacac    c.*2160

         .         .         .         .         .         .    g.40575
gaagccccacagcgtgtgcccgcgtcccccgaggtcagccggcggctcctgcccttccct    c.*2220

         .         .         .         .         .         .    g.40635
ctgacctctggttgggggccggccatttttctgcttgttcctctagctctgctactgggc    c.*2280

         .         .         .         .         .         .    g.40695
acatggtccgtgctgggtaggctgcaggccagggtgagttgctgacccgctgaccctggc    c.*2340

         .         .         .         .         .         .    g.40755
tgtgcacctgccctcctgccctgggtggctgctgctggcccaggggtgacttgggggctt    c.*2400

         .         .         .         .         .         .    g.40815
tcaagcttctgcccgtgctggccgcacgaccccacgtcccaccctgggtagggacttgtg    c.*2460

         .         .         .         .         .         .    g.40875
attctcagagctggggtccgttgctttcctaaggacctccggccctggtcgtggtctaaa    c.*2520

         .         .         .         .         .         .    g.40935
tgctcactcctgttgttggagaggccagccgggtgacagggaaaagcccagagccccggg    c.*2580

         .         .         .         .         .         .    g.40995
cttcccgtgaggatctgggctcagcatgggctgtggggctgcagaggcctggccttgcct    c.*2640

         .         .         .         .         .         .    g.41055
gctgagggacacccgctggtagtgcctgcagaggggggaggaggaattcctccccctagt    c.*2700

         .         .         .         .         .         .    g.41115
gccctctggaccctgggagagcaagacctctgcatccacactgccttccgctgggcctct    c.*2760

         .         .         .         .         .         .    g.41175
ggggactggggaagcggacacagtccaggactgttggaggaggaagaggctgcggctgct    c.*2820

         .         .                                            g.41203
cttccctgggggtccggctccaggaggc                                    c.*2848


Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center