D-2-hydroxyglutarate dehydrogenase (D2HGDH) - 437 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5141
gtgcgtgcgcgcggccgcgcggagcgctgggctgagggtcccggtctgcggttcagccgc  c.-93+60

         .         .         .         .         .         .  g.5201
gggtcggggtggcggggcgcgatctcgggcgccgtcagccagtcggtgcctgtgggggga  c.-93+120

         .         .         .         .         .         .  g.5261
gggggacggcgctgcagctcgtcacgtgaccgcgtggaacacgcgcgcgcgtccgcggga  c.-93+180

         .         .         .           g.5300
tcccctcggggggcgagctcggaggaacggggtcctggg  c.-93+219

--------------------- middle of intron ---------------------
           g.5301             .         .         .           g.5338
           c.-92-218  caaggtcccggcgaggccgccccgagcctgcgcgtcgc  c.-92-181

.         .         .         .         .         .           g.5398
taagtccaggcctgctgcgtggggcttcgcgcgctcgcggggttgcggcccgggcagggg  c.-92-121

.         .         .         .         .         .           g.5458
gagggcccgggtgctcggagccttcccttcgctgccctcctgccccctccctgcttctgc  c.-92-61

.         .         .         .         .         .           g.5518
aagcgtgtttcaatttgtacaacgtgcataaaacatgaaattacccttggccacttccag  c.-92-1


Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center