D-2-hydroxyglutarate dehydrogenase (D2HGDH) - 5516 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5962
gtgggtgaggcttgggaagctgcggcgtttccgcgtccctgctccgctgcgccttcccgt  c.292+60

         .         .         .         .         .         .  g.6022
ggaggcttcaaagcgggctgagaacaacctggatgggggtgccagcccctggctgcgctg  c.292+120

         .         .         .         .         .         .  g.6082
agaggggcgtgtgcaccgccacaggctgctggaatgaatgaccacgaacgagtcgcttag  c.292+180

         .         .         .         .         .         .  g.6142
aacaacccaagttttgttgttgttgttgttttgttttttcttttttttaagacggagtct  c.292+240

         .         .         .         .         .         .  g.6202
cactctgtcgccaggctggagtgcagtcacggagtttcactctgtcgccaggccggagtg  c.292+300

         .         .         .         .         .         .  g.6262
cagtggcgcgacgtcggctcactgccacctctgcctcccgggttcaagcgatttgcctgc  c.292+360

         .         .         .         .         .         .  g.6322
ctcagcctccctagtagctgcgactacaggcgcccgccaccacgttccgctaatttttgt  c.292+420

         .         .         .         .         .         .  g.6382
atttttagtagagacagggtttcaccatgttggccaggatggtctcgatctcttgacctc  c.292+480

         .         .         .         .         .         .  g.6442
gtgatccgtccgcctcggcttcccaaattgctgggattacaggcgtgagccaccccgccc  c.292+540

         .         .         .         .         .         .  g.6502
tgccaacaacccaagtttgcctggcgcagtggctctgcctgtaatctcagctgccctgga  c.292+600

         .         .         .         .         .         .  g.6562
ggctgaagccaggagttcaagaccagcctgggcaacatagccagaacccccgccccactc  c.292+660

         .         .         .         .         .         .  g.6622
acctctaaaaataaaaataaataaataaaagtagccggcccaggattgaaaaaacaaaaa  c.292+720

         .         .         .         .         .         .  g.6682
gtaaaaaagttactccagcccaggagttccagttttagtggactatgatctcaccactgc  c.292+780

         .         .         .         .         .         .  g.6742
attccagcctgggcaacagagcaagactacatctctaaaacaaaacagaattcccctccc  c.292+840

         .         .         .         .         .         .  g.6802
caccaaaccccacaagtttgttctctaagctctggaggccaaaagtgtgaaatcagggta  c.292+900

         .         .         .         .         .         .  g.6862
tcacagggctgcgctccctccaaagcctccagaggaggctccttcctgcctcttgtagct  c.292+960

         .         .         .         .         .         .  g.6922
ctagctcctggtggccccaggtaccaaattactccagtctctgcctctgtttttcataca  c.292+1020

         .         .         .         .         .         .  g.6982
ggtttttcttctctgtgactcttctccagttgtcttataaagacacttctcattggattg  c.292+1080

         .         .         .         .         .         .  g.7042
agggcccaccctaatccaggatgatcgtatctcagtactgtcaacttaattacatctgca  c.292+1140

         .         .         .         .         .         .  g.7102
aagaccgtttatccgttttttttttttttggagatgaagtctcactctttttgcccaggc  c.292+1200

         .         .         .         .         .         .  g.7162
tggagtgcaatggtgcaatcttggctcactgcgaccttcccctcctgggtgtaagcaatt  c.292+1260

         .         .         .         .         .         .  g.7222
cagcctcccaagtaactgggattacaggtgcccgccaccatgcccggctaatttttgtat  c.292+1320

         .         .         .         .         .         .  g.7282
ttttagtagagacggggtttcaccatgttgaccacgctggtctcgaactcctgacttcgg  c.292+1380

         .         .         .         .         .         .  g.7342
gtgatccactcacattggcctcccaaagtgctgagatgacaggcatgagccactgcactt  c.292+1440

         .         .         .         .         .         .  g.7402
agctggaccgttttttctttttgtttttttgagacggagtctcgctctgttgcccaggct  c.292+1500

         .         .         .         .         .         .  g.7462
ggagtgcagtggcgtgatctcggcttactgcaagctccgcctcctggcttcacgccattc  c.292+1560

         .         .         .         .         .         .  g.7522
tcctgcctccgcctcccgagtagctgggactacaggcgcccgccaccacgcccggctcat  c.292+1620

         .         .         .         .         .         .  g.7582
tctttttgtatttttagtagagacagggttttatcgtgttagccaggatggtctcaatct  c.292+1680

         .         .         .         .         .         .  g.7642
cctgacatcgtgatccgcctgcctcggcctcccaaagtgctgggattacaggcatgagcc  c.292+1740

         .         .         .         .         .         .  g.7702
accatgcccagccccattttttcaaataaggtcccattcacaggtcttggggcattggga  c.292+1800

         .         .         .         .         .         .  g.7762
agcagacgtatctttttggagcccattaggtaagatgcagggctcctggccaacaatgcc  c.292+1860

         .         .         .         .         .         .  g.7822
tgctcctctcctcccactgcacttctgcccagtggcatacaagtctgtgcacgaatgagg  c.292+1920

         .         .         .         .         .         .  g.7882
gacttctcagcctctggggctggcacttccttttggtaacagtgcccagttttctctttt  c.292+1980

         .         .         .         .         .         .  g.7942
tttatttttttgagatggagtcttgccctgtcactcagggtggagtgcagtggcacgatc  c.292+2040

         .         .         .         .         .         .  g.8002
tccccttactgcaacctccacttcctggggtcaagcgattttcctgtctcagcctcctga  c.292+2100

         .         .         .         .         .         .  g.8062
gtagctgggactacagctgggttacacgcctgtaacccagttctgtgggagatcgcttga  c.292+2160

         .         .         .         .         .         .  g.8122
gcccaggagttcaagaccagcctgagcaacatggtgaaactctatctctacagaaaatta  c.292+2220

         .         .         .         .         .         .  g.8182
aaaattagccgggtatggtggcatgtgtctgtgtgctaaaatagtaaagcgaggtagaag  c.292+2280

         .         .         .         .         .         .  g.8242
agaattggttgactcttaatttacaacaaaatgatatatttaaacctgtggaactggcac  c.292+2340

         .         .         .         .         .         .  g.8302
caggtcctggggctgaacatagggtgtgctgtcattgggaagatctggaattgtttttat  c.292+2400

         .         .         .         .         .         .  g.8362
cttttttttgttggcccttgtagaagattgaaattattaagaacactcagaaagtttcca  c.292+2460

         .         .         .         .         .         .  g.8422
gaccgtgtaatctgggagtgcagcgtatgttaaaacagttcagaaagttagcaagttgaa  c.292+2520

         .         .         .         .         .         .  g.8482
ctggggtctaggctcagataatggaagcagctctttccctgcagaaaggctgggagtcac  c.292+2580

         .         .         .         .         .         .  g.8542
tggaaatcgctggaccaatggtcactgtgtaggagctctcttgagtggaagggcccccac  c.292+2640

         .         .         .         .         .         .  g.8602
cctcaccctgctcccgaagtaaggacccctctggggcgatctcaagctgctgccctgagt  c.292+2700

         .         .         .         .         .          g.8660
gcacaccatggcccagggcctgtgggctcacgaatgttgtccccggaggcaggtgagg  c.292+2758

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.8718
  atggacgcccaccctgggcttggctaagtcgggccccagtcctggctcagcactgctg  c.293-2701

.         .         .         .         .         .           g.8778
tctgggtggccctaggcagatgaccctcagtgcctgccctacaaaatgggacttggagcc  c.293-2641

.         .         .         .         .         .           g.8838
actgcctcaggaacaccgtgcgggtaagtggggcaggaacctagcgtgagccttgagcac  c.293-2581

.         .         .         .         .         .           g.8898
aatgcttgggttcccgtgctcccagcctgctcggaggccagcaccctgggctatgccgct  c.293-2521

.         .         .         .         .         .           g.8958
gctgccctcatgggcaagggacctccccggggcatgcaggagcggggaggaagctgtaac  c.293-2461

.         .         .         .         .         .           g.9018
tgagattgaggggtgaccacgctcttcctctcctctgccttgcctgagcctgactgggca  c.293-2401

.         .         .         .         .         .           g.9078
agaactggctgtccccctgggtccccgctctctggtcagcacctttttgggaatccgtgg  c.293-2341

.         .         .         .         .         .           g.9138
ccatggacaccctgtcctgctgcagggccgcccctcggtgtctgtgtgtgcctgtgggag  c.293-2281

.         .         .         .         .         .           g.9198
ggcgccttcctctgcgtcctgctgccccgagtttggtgagggcgaggctgaatttcactc  c.293-2221

.         .         .         .         .         .           g.9258
atgtttgagtccacaggtttggtcctgaatgtctgctcagtaggtgtttgctgatgtgag  c.293-2161

.         .         .         .         .         .           g.9318
gcttagttgttgaattttaggtgaattatcccttcatgtggcttgcttttggagagagag  c.293-2101

.         .         .         .         .         .           g.9378
cttgtctagacttctgaaaactcattaagcatcatattcaaaaatctagaccatttgctc  c.293-2041

.         .         .         .         .         .           g.9438
aggatggatgctgcagacgtttagtgagcacgcctgcactggcaggaaggtgggagcttc  c.293-1981

.         .         .         .         .         .           g.9498
gcggtgtgaaaacaggctgggcccctgtgtcacctctggcggccttgcccccatggcccc  c.293-1921

.         .         .         .         .         .           g.9558
ctccgtctttgtggggctcccatcgttaacactggaccaccgggagggagccctcctttt  c.293-1861

.         .         .         .         .         .           g.9618
catctttcccgttagaaggtaaacatcacaggagtgggaaattctgtgctcattctgtgt  c.293-1801

.         .         .         .         .         .           g.9678
ctggaacgcggcctggcctgcattcttggggggtactcatgtttgtgttgagaaccctgc  c.293-1741

.         .         .         .         .         .           g.9738
cacaggcgcgtcacaagtgtgtccgagtcgaaagctttgccatgagtcctggggctcctg  c.293-1681

.         .         .         .         .         .           g.9798
agcccactcgggacagggacgcagtgagcgcaggtgccagggttccctcaggtgccgcac  c.293-1621

.         .         .         .         .         .           g.9858
tgaagtgtcgggccgaggcccaggtgcccagcaggcccctctgcaaaaattgctcatttg  c.293-1561

.         .         .         .         .         .           g.9918
atgaaagagacataagtggctttctgatcagaaaagcaaggtggacaccacagcctggtt  c.293-1501

.         .         .         .         .         .           g.9978
ctcagagctccacgaagaggtgacaggctcccgtgactgcacctgctgcctctctgcagc  c.293-1441

.         .         .         .         .         .           g.10038
ccccatcacctgggaaagtcgtctcaaggaaacccaaaggcagaaagacgcctgctcact  c.293-1381

.         .         .         .         .         .           g.10098
tggggcagcagtggttagcaacaccggcgaactagctcagagggctcccactggtcacat  c.293-1321

.         .         .         .         .         .           g.10158
ccaggcattcagcaaataaggcggccaagacttatagcccagtgaataaagtgagaagcc  c.293-1261

.         .         .         .         .         .           g.10218
gagagcccacatcactgtgaataagcagctacataaacacgtcagtgagagcgaagggaa  c.293-1201

.         .         .         .         .         .           g.10278
agccctccctcgtggcagagtcagctaagaggccgggcgcggcgactcatgcctgtaacc  c.293-1141

.         .         .         .         .         .           g.10338
acagcccttagggaggctgaggtgggtggattgcttgaggccatgagttcaagatcagac  c.293-1081

.         .         .         .         .         .           g.10398
tggggaacatggtgaaaccctgtttctactaaaaatatcaaaattagccgggcatggtgg  c.293-1021

.         .         .         .         .         .           g.10458
caggcacctgtagtcccagctgcttgggaggctgaagcaggaggatcgcttgagctcagg  c.293-961

.         .         .         .         .         .           g.10518
aggttgaggctgcagtgagctgtgattgtgtcactgtactccagactgggtgacggagtg  c.293-901

.         .         .         .         .         .           g.10578
agaccctgtttcaaaagaaataaaaggaagtgtaggtggacagatggatttaggaaaatc  c.293-841

.         .         .         .         .         .           g.10638
accagttggcaaccatcctagtaactgatttggtctaggataatcaaagatgttaatggg  c.293-781

.         .         .         .         .         .           g.10698
tgaagcttgaggagcaacaggatgtccacatagtctcaagcgtctgcttgtgaggtgcac  c.293-721

.         .         .         .         .         .           g.10758
acacatcacgaaaggaagtgtggtggcgtggcaggagggaagcctgcagacatcccgtta  c.293-661

.         .         .         .         .         .           g.10818
ccgtgggaccgagccgacctcaccacaagtgggtgggcaaccttggagctgccaatgcct  c.293-601

.         .         .         .         .         .           g.10878
ggcctgtgggactctcatccatgggcccagccttacccacttctgcacactgtgcccagt  c.293-541

.         .         .         .         .         .           g.10938
gcccggcccaccacctcccatgtgggacctagttttggtttttttgagatggcttcttgc  c.293-481

.         .         .         .         .         .           g.10998
tctgtcacccaggctggagtgcagtgttgcgatcatagctcactgcagccttgacctcct  c.293-421

.         .         .         .         .         .           g.11058
ggactcagatgattctccctcctcagcttcccaaataagatcactctctgggggctgggc  c.293-361

.         .         .         .         .         .           g.11118
atggtggctcatgcctgtaatcccagcactttgggaggccgcagtgggcggatcacgagg  c.293-301

.         .         .         .         .         .           g.11178
tcaggagttcgagaccagcctggccaatgtggtgaaaccctgtctctactaaaaatacaa  c.293-241

.         .         .         .         .         .           g.11238
aaattagccaggtgtggtggcgggtgcctataatcccagctacttgggaggctgaggcag  c.293-181

.         .         .         .         .         .           g.11298
gagaatcgcttgaacctgggagggagaggttgcagtgagccaggatcgtggcacttcagc  c.293-121

.         .         .         .         .         .           g.11358
ctgggcaacagagtgagagtccgtctccaaaaaaaaaaactcgctctctggggcgagtga  c.293-61

.         .         .         .         .         .           g.11418
ccacttgcctcatctgcagctccccccacgctgtctcataggatcttcttcctgtcacag  c.293-1


Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center