D-2-hydroxyglutarate dehydrogenase (D2HGDH) - 1344 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.11536
gtgaggtggtggctcccggctcccccagccttccctgttgcctgtgggtcatttcctcat  c.350+60

         .         .         .         .         .         .  g.11596
ggagcctgtgggcagctggggtgacgcggtgcgaagccagccgatgacatcttggtttgt  c.350+120

         .         .         .         .         .         .  g.11656
gtgtctcagtgtttgttctgtggtttttcggtgctatctcaatgcatctgtggtgtgtaa  c.350+180

         .         .         .         .         .         .  g.11716
tcatttccccccatttggcaatgcccatgcccatttcttggcactgtctgtaacagcaaa  c.350+240

         .         .         .         .         .         .  g.11776
gctcctcccccatgaacacactacagggtggcactggtctccgggtgtccatgactgtgg  c.350+300

         .         .         .         .         .         .  g.11836
acagtgctttagatcatcctcagcaggtgctttggggcaacgtgcacttactctgttaaa  c.350+360

         .         .         .         .         .         .  g.11896
ctccatccctgggacttgctgtctccagggtttatttcatgtgtggggcttgctgtctcc  c.350+420

         .         .         .         .         .         .  g.11956
agggtttatttcatgtgtggggcttgctgcctccagggtttatttcatgtgtggggcttg  c.350+480

         .         .         .         .         .         .  g.12016
ctgtctccagggtttatttcatgtgtgggacttgctgtctccagggtttatttcatgtat  c.350+540

         .         .         .         .         .         .  g.12076
ggggcttgctgtctccagggtttatttcatgtgtggggcttgctgtctccagggtttatt  c.350+600

         .         .         .         .         .         .  g.12136
tcatgtatggggcttgctgtctccagggtttatttcatgtatggggcttgctgtctccag  c.350+660

         .    g.12148
ggtttatttcat  c.350+672

--------------------- middle of intron ---------------------
                                     g.12149      .           g.12160
                                     c.351-672  gtgtgggacttg  c.351-661

.         .         .         .         .         .           g.12220
ctgtctccagggtttatttcatgtgtggggcttgctgcctccagggtttatttcatgtgt  c.351-601

.         .         .         .         .         .           g.12280
ggggcttgctgtctccagggtttatttcatgtgtggggcttgctgtctccagggtttatt  c.351-541

.         .         .         .         .         .           g.12340
tcatgtacatgggcagattccttttcccagagcacggaactttggtttctccaaacccct  c.351-481

.         .         .         .         .         .           g.12400
agccactgggtgtgctctaggctttggggctttgcaaaggtgcaggctggttgggaggga  c.351-421

.         .         .         .         .         .           g.12460
ggtatccttgggcacacgtctgggggataatgggccgagggtggggagatgcaggcagag  c.351-361

.         .         .         .         .         .           g.12520
ggtggaaggcagtgggggcagtgcggtcgaggaaccctgagctggaccctctgtgagcat  c.351-301

.         .         .         .         .         .           g.12580
ggtgtgaacgggaaggatgggagccgggcgtgtaggacgttctgtcctttgagggaagcc  c.351-241

.         .         .         .         .         .           g.12640
ttgtaggacgtcagaatcggggcctccacttccgtctccctgtgcacagctttcggattg  c.351-181

.         .         .         .         .         .           g.12700
gcctctgtccttcctcagaatccctcacatgcgtgggctggggaggagcccccgctgagg  c.351-121

.         .         .         .         .         .           g.12760
ctgcaggcagggcagggtaatcaggatttggagtcaggcactggtcctgcggcgtgtcct  c.351-61

.         .         .         .         .         .           g.12820
tggggatggtggcgtaggggtggggacagagccccaacgtccctcctgtcctcatcccag  c.351-1


Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center