D-2-hydroxyglutarate dehydrogenase (D2HGDH) - 1047 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.13020
gtaagcctgtgccacccgtcggggcccaggagtccctcctggtgctggtggagttcttcc  c.490+60

         .         .         .         .         .         .  g.13080
ttgccagcgtctgcaactgtggggtgcttgggtgggtgaatgagttagggccggcgctgg  c.490+120

         .         .         .         .         .         .  g.13140
ggaaagaaccagcgtctgtagcctggccgcctagccccacctcgcccggcccctccagac  c.490+180

         .         .         .         .         .         .  g.13200
atgcgtgctggtgagggcttgtcattctggtcccttccgactccatcccgctctagaggt  c.490+240

         .         .         .         .         .         .  g.13260
gtgtgaggtgcagagtggcatgtgtgaggggatcctgacccagggtgccagggcgtggca  c.490+300

         .         .         .         .         .         .  g.13320
ggcatgaggggatcctgacccagggcgccagggcgtggcaggcgtgaggggatcctgacc  c.490+360

         .         .         .         .         .         .  g.13380
cagggcgccagggcgtggcaggcgtgaggggatcctgacccagggcgccagagcgtggca  c.490+420

         .         .         .         .         .         .  g.13440
ggcatgaggggatcctgacccagggcgccagggcgtggcaggcgtgaggggatcctgacc  c.490+480

         .         .         .         .      g.13484
cagggcgccagggcgtggcaggcgtgaggggatcctgacccagg  c.490+524

--------------------- middle of intron ---------------------
      g.13485       .         .         .         .           g.13527
      c.491-523  gtgccagggcgtggcaggcatgaggggatcctgacccagggcg  c.491-481

.         .         .         .         .         .           g.13587
ccagggtcctgctctggagctgggcctctccccgcaaggccgggctccaggccccggtca  c.491-421

.         .         .         .         .         .           g.13647
ctctgtggtcgggcgcctgcactgttgggtgttgagcagcatccttggcctccgcctaca  c.491-361

.         .         .         .         .         .           g.13707
aggtgcccatggcacccccaacccaggcattgtcccacatgcccagggcaggatcagccc  c.491-301

.         .         .         .         .         .           g.13767
cagctgagaatcttccctcttctactcctttccacgagtgtgtgtgggggtgggaagttt  c.491-241

.         .         .         .         .         .           g.13827
tttcctctcttttcatgttactcattttttttttgtgtcaccataattataaaggtcctg  c.491-181

.         .         .         .         .         .           g.13887
tgaggcccagatgttttcgtccttgggccagcgatgtgggggtgcctcttctcctcagcc  c.491-121

.         .         .         .         .         .           g.13947
ctggcgctgaggctgatgttccttctgggtggcttgcctgtgcaagatgggggttgggac  c.491-61

.         .         .         .         .         .           g.14007
tcaccagcccgggggcccactggaagccaagtgctgcggcagcctggtcactctctgcag  c.491-1


Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center