D-2-hydroxyglutarate dehydrogenase (D2HGDH) - 893 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.14261
gtgagctggggcagctgcttggtgcagaggtcgccacggggtgtcctctcacggctctca  c.684+60

         .         .         .         .         .         .  g.14321
tgggcccacgtggtggcacaggtgcatggggcccctcggggtgggaggtcttggttcctg  c.684+120

         .         .         .         .         .         .  g.14381
gccctgggcccctcaaggatgtgtgggctacatacacccccatcctgagggaggcctggc  c.684+180

         .         .         .         .         .         .  g.14441
cctgccctgtcctcccacgagagggtgattttgtgtccactgcctcggggccacacagag  c.684+240

         .         .         .         .         .         .  g.14501
aggatgcagttacaggggacaccgccccggcagtggtgggcttctgggagccgggtgtga  c.684+300

         .         .         .         .         .         .  g.14561
aggaaggctcatccagggtcagcttcgtgaccttctgctgcccactgttcctccagggcc  c.684+360

         .         .         .         .         .         .  g.14621
cctctgtttacccgcaccctcaccagccgagtgtcacaggcagagctctctgtcctgttt  c.684+420

         .         .         g.14648
acccaagtggacgaagcaaacacaaaa  c.684+447

--------------------- middle of intron ---------------------
                       g.14649          .         .           g.14674
                       c.685-446  ccatgctttggtgccatccagtaaat  c.685-421

.         .         .         .         .         .           g.14734
tatgacgcttcagtagcttttttttctggccagccactgattatctttattgtaaattac  c.685-361

.         .         .         .         .         .           g.14794
ttttttgcactcatgagctgtgtaggcctccgactcacagtaccagcacacaggactcgg  c.685-301

.         .         .         .         .         .           g.14854
agaggcccacagctcgggagctttgatgccttatggctggtgggtccagaggtggctggg  c.685-241

.         .         .         .         .         .           g.14914
tcctgggctgggctcacgccctactcccagggagcctccccactgcccccgaccccgggc  c.685-181

.         .         .         .         .         .           g.14974
gtgccccctgggcagtgagctgctgtgtgtggagggtgtcactcgtacaggaggaaagtc  c.685-121

.         .         .         .         .         .           g.15034
catccttcagcctcttggcatgacctcaggctgctgcagaagtgacacctggccccggag  c.685-61

.         .         .         .         .         .           g.15094
gcgaccgacgtcttgtcaggaggctggcaggtgggtgaacgtgcttctctttgccccaag  c.685-1


Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center