D-2-hydroxyglutarate dehydrogenase (D2HGDH) - 951 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.20740
gtactgaccccccacacagggggcagctggtcctgcagctccttctgcacgtctggacac  c.997+60

         .         .         .         .         .         .  g.20800
atgggacggctcagagaccccgggtgggcggggggtgcccgggcgggcgggtggggggtc  c.997+120

         .         .         .         .         .         .  g.20860
cctgggcggagcatggagtggccgttgggctcatgtgtaagaaagctgctcttaacatat  c.997+180

         .         .         .         .         .         .  g.20920
ttaggacaaagaacaggctgccctggtcctgtgtaaggtttgtagttacacagatttcct  c.997+240

         .         .         .         .         .         .  g.20980
gatcttctgcaggaaggacgggaaggaactaagtggctatttttggtgagctgggagact  c.997+300

         .         .         .         .         .         .  g.21040
ttctttccatttcttcttttctttgttttcccatgttgctttctgtaagcacgtttttct  c.997+360

         .         .         .         .         .         .  g.21100
tttatgctgggaaaaaagccaataattttttgttgttgggggatggagtttcgcactgtg  c.997+420

         .         .         .         .         .        g.21156
gcccaggctggagtgcaatgtcacgatcttggctcactgcagcctccacctcccgg  c.997+476

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.21211
     attcaaaccattctcctgcctcagcagcctccacctcccgggttcaaacgattct  c.998-421

.         .         .         .         .         .           g.21271
tctgcctcagcagcttccacctcccgggttcaaacaattctcctgcctcagcctcctgag  c.998-361

.         .         .         .         .         .           g.21331
tagctgggattacgggcacctgccaccacactcagctaatttttgtatttttagtacaga  c.998-301

.         .         .         .         .         .           g.21391
cagggttttgccgtgttgtccaggctggtctcgaactcgtgacctcaggtgatccaccca  c.998-241

.         .         .         .         .         .           g.21451
cctcagcctcccaaagtgctgggattacaggtgtgagccactgtgcccggccaaagacga  c.998-181

.         .         .         .         .         .           g.21511
ctttttaaaccttctgaaagtcagcttaaccagagagctgtgtgctccgcaggctgcctg  c.998-121

.         .         .         .         .         .           g.21571
ggtccttcttggccacgaaagatcagtggttgctattacagctgttctgcccgagcagcc  c.998-61

.         .         .         .         .         .           g.21631
ctgattcttgccctggcagccggagcctctgctcactctgccttccttgctcacttctag  c.998-1


Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center