D-2-hydroxyglutarate dehydrogenase (D2HGDH) - 4460 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.21834
gtgccctgtgtcctgcttgcaggtccccgctctctgtccgtccagtccagccttgtcttg  c.1140+60

         .         .         .         .         .         .  g.21894
ggatgcctggaacggtcattggtgcagcctagacagtgtgggatgtggctgaaatgtgac  c.1140+120

         .         .         .         .         .         .  g.21954
tgggtttcatggctttgagagagtagcctctttggatggaaaatgtattcctggtgtcta  c.1140+180

         .         .         .         .         .         .  g.22014
ggccattttcattaatatttaaaaagtacttcctccccaccatgaccctccccaacccca  c.1140+240

         .         .         .         .         .         .  g.22074
tgctgtgggatgagcaaggggactgccccattgctggtcccctgcagcctgtggttaagc  c.1140+300

         .         .         .         .         .         .  g.22134
ggccagtcagcggcagctccgcatagagtcgtgtggaaggagtggaggcaggaggagccc  c.1140+360

         .         .         .         .         .         .  g.22194
ctggggctgtggaggcttagcctggacctcgggagtcctaggatgggcagttttccttcc  c.1140+420

         .         .         .         .         .         .  g.22254
ctaggaggaaggggcgttgactgtgtgaccagatgatttggccttttgaggccaaaggaa  c.1140+480

         .         .         .         .         .         .  g.22314
ggaggggcaaggcctgggcagggggagccctcggtcaccgtcaccggggcctgggcaggg  c.1140+540

         .         .         .         .         .         .  g.22374
ggagccctcggtcaccgtcaccggggcctgggcagggggagccctcggtcaccgtcaccg  c.1140+600

         .         .         .         .         .         .  g.22434
gggcctggatagtgggagccattggtcactgttaccgggacctgggtgggaggagccctc  c.1140+660

         .         .         .         .         .         .  g.22494
agttaccttcaccggggcctgggcagtgggaggcgcccttggtcaccgtcaccagggcct  c.1140+720

         .         .         .         .         .         .  g.22554
gagcagtgggcgcaggactttactcccgcttagttgatttcaggctcgtgttagcctggg  c.1140+780

         .         .         .         .         .         .  g.22614
tgttgcccttgccatcttcccccctcacctttgccgcctgactgtcatgattccagtgct  c.1140+840

         .         .         .         .         .         .  g.22674
tctgggcaaaacggtgtctgctcccaagggctggggtgcggtcggctgggctcacttgtg  c.1140+900

         .         .         .         .         .         .  g.22734
tgtcctgatgcccagcccaggggcgtcctctgggcgaatggcagctgtgtggtgccatct  c.1140+960

         .         .         .         .         .         .  g.22794
ctgttgactgaggcatgatcaagtgtgcgtccttcctaggtctctgcctgccattcctgc  c.1140+1020

         .         .         .         .         .         .  g.22854
atttttctaagtggactgtgacagtcagctcccttacattctgccgcagtaacaagcaat  c.1140+1080

         .         .         .         .         .         .  g.22914
ccccaggccccagggaccacacgaacagaggctcaccctccctcgcgttccgtgtgggtg  c.1140+1140

         .         .         .         .         .         .  g.22974
atcgctgtggctgcatgtgctcctgtggcttccagtccaggggcccgggctgaggcagct  c.1140+1200

         .         .         .         .         .         .  g.23034
gcccagccagtcagtctgttttcccagcagaaagagcaggacagccgccggggattctct  c.1140+1260

         .         .         .         .         .         .  g.23094
cagcttctgcttgagatggggcgggaacgtgagcccaactgcccttggtggtgcgggtgg  c.1140+1320

         .         .         .         .         .         .  g.23154
ggaccctcatcccgcactggctgctttgctggagtggcagtcagtcatgcagcccccaca  c.1140+1380

         .         .         .         .         .         .  g.23214
ccacccccaggagggcgaccctggcaccccagcctccacacatcagcccccatgccccca  c.1140+1440

         .         .         .         .         .         .  g.23274
caaaggaaggctgcccccaacacccccaacctctctaccagcccccatgccacccccagg  c.1140+1500

         .         .         .         .         .         .  g.23334
gcgggccgtcctccatgcccccagcctctgcacatcatcccccacgccacccccagggcg  c.1140+1560

         .         .         .         .         .         .  g.23394
gactgtccccaacgcccccagcctctgcacatcagtccccagcccctccacagcctggtc  c.1140+1620

         .         .         .         .         .         .  g.23454
cagtcctagacctgtgccttgaacattaatgcccagagccgggttcatgaccaggacagg  c.1140+1680

         .         .         .         .         .         .  g.23514
gccgaatggggctggttctgtgttcacaaagtcacctccagacgcttcctgggacgggtt  c.1140+1740

         .         .         .         .         .         .  g.23574
caggagacgccttgtgtgtctgtcacctcgttctggctcatgctcgacgggtaggtaatc  c.1140+1800

         .         .         .         .         .         .  g.23634
tggcctttgttttctgcagatagcaaaacgaccctttcttaggtgtgcggctcgatgagt  c.1140+1860

         .         .         .         .         .         .  g.23694
tgacccggatatgcggttgtgtgcagttgctctgaggcttttctgtgctgttgtccggtg  c.1140+1920

         .         .         .         .         .         .  g.23754
ttggcgaggctctgggcaggtcctgaggcttttctctgctgttgtccggtgttggcgagg  c.1140+1980

         .         .         .         .         .         .  g.23814
ctctgggcaggtctgggcaggtcctgaggcttttctctgctgttgtccagcattggcgag  c.1140+2040

         .         .         .         .         .         .  g.23874
gctctgggcaggtcctgaggcttttctctgctgttgtccggtgttggcgaggctctgggc  c.1140+2100

         .         .         .         .         .         .  g.23934
aggtcctgagccattctgctttccactctgtggtctttcccttctgggagccctgggttt  c.1140+2160

         .         .         .         .         .         .  g.23994
ttggacatgttgagacaatggggcttgcgcaggtccagccgctgccgcgggggccctgtg  c.1140+2220

         .  g.24004
ttcaacgggg  c.1140+2230

--------------------- middle of intron ---------------------
                                     g.24005      .           g.24014
                                     c.1141-2230  gacactcagc  c.1141-2221

.         .         .         .         .         .           g.24074
cctgcccaggccccgctgtagcctcagcccacccgagtggaagccacactggtcgcacca  c.1141-2161

.         .         .         .         .         .           g.24134
gatgccccgggctcctctgagtagtgaccacggcgggtctcattggcactgcctatccac  c.1141-2101

.         .         .         .         .         .           g.24194
ccgtcacgtgtcattcagttagcaaacctgctagggagatgcctcctgtgccctgtgcct  c.1141-2041

.         .         .         .         .         .           g.24254
gccgggcgacagcagtgaccagggcgggagaagccttgccccataaactcacgcagcaga  c.1141-1981

.         .         .         .         .         .           g.24314
aggaacaagctcagcccatggcccctcagagccaggaagcgccggggaggagggcagggc  c.1141-1921

.         .         .         .         .         .           g.24374
caggcagggtcatggggtgtgccggggagtgccgggagggccggaaagatgaccctgagg  c.1141-1861

.         .         .         .         .         .           g.24434
ggtcatttcagcaaagacggggtgtggggagcagaacgtctggtgcaggagcaccaagac  c.1141-1801

.         .         .         .         .         .           g.24494
cctgaggggcgcgtgcctgccatgttctagaaccttccagagatggtgggtgtggagctg  c.1141-1741

.         .         .         .         .         .           g.24554
agtgactgaggcgtgagcagacaagggtagagcccatcttgtggccacggggacacatgg  c.1141-1681

.         .         .         .         .         .           g.24614
ggcggccggtctgatgaggaggtaagaaggcctcacaggcagccgatgcccgccagacca  c.1141-1621

.         .         .         .         .         .           g.24674
tggaggcgaaagccggcctcgcagccgtgcccgtgcggctgtgacgaagggaccgtagga  c.1141-1561

.         .         .         .         .         .           g.24734
ggggctcttgctcagggcagggcgtgacccaagggtctgatctgaccgaactagctctag  c.1141-1501

.         .         .         .         .         .           g.24794
aagtttgtaaaaggggccgggcacggtggctcatgctgtaatcccagagctttgggaggc  c.1141-1441

.         .         .         .         .         .           g.24854
tgaagcaggaggatcacttgagcccaggagtttgagacgagcctgggcaacatcgggaga  c.1141-1381

.         .         .         .         .         .           g.24914
cttcaaaaaaacaaaaaattgatggtggggaaatgcgggaattttgggcgccggccggat  c.1141-1321

.         .         .         .         .         .           g.24974
tcccagtggtggcgaggaggtggtatttttttaagtgtcagtgtggcattgtggttgcct  c.1141-1261

.         .         .         .         .         .           g.25034
caataaaacagagtctttttttgtcttttttttttgagacagggtctcgctctcacccag  c.1141-1201

.         .         .         .         .         .           g.25094
gctggagtgcagtgacacagttgcagctcactgcagcctcgacctcctgggctcaagcaa  c.1141-1141

.         .         .         .         .         .           g.25154
tcctcccgcctcagcctcccgagtagctgagtctacaggtgcccaccaccaaacccagct  c.1141-1081

.         .         .         .         .         .           g.25214
gatttttattgtttttaagagacggggtctccctgtgtggctcaggctggtctgaaactc  c.1141-1021

.         .         .         .         .         .           g.25274
ctgggctcaagtgatcctcctgcctcagcctcccaaagctctgggaatacaggcgtgagc  c.1141-961

.         .         .         .         .         .           g.25334
cactgcgcccggccaagtgtttctcttagaatttcctgaaatgatagggtctctggaggg  c.1141-901

.         .         .         .         .         .           g.25394
gcaggtgctgggcttgagccctgggtaggaccctgcaggggagaggtggtcctgcagccc  c.1141-841

.         .         .         .         .         .           g.25454
acagaggatggctctgtcctgttcctcatggtgcagatctccacaatggaagttcgaagc  c.1141-781

.         .         .         .         .         .           g.25514
aagcaaaagccacgcaaaccacaggccgatctgtctgagccctaggatttggcccggttc  c.1141-721

.         .         .         .         .         .           g.25574
tgcttcagccaccagcaccgtctgctcctcctcagaatccttcctcccccgtggcccgcc  c.1141-661

.         .         .         .         .         .           g.25634
cgccgtgtccctcctcctccacggcccgcccaccgtgtccttccctcccccgtggcccac  c.1141-601

.         .         .         .         .         .           g.25694
ccaccatgtccttccctcccctgtggcccacccgccatgtccctgcctcccacccgacat  c.1141-541

.         .         .         .         .         .           g.25754
gccccttgagctgcctgggccctgctgttgtccccactgcctgtgtgactctgcgccccc  c.1141-481

.         .         .         .         .         .           g.25814
ttccctaccctgccccaccctggttcagggagcgtccaggcccattctcatcctcagggc  c.1141-421

.         .         .         .         .         .           g.25874
cttccctggcccttgccactctgtgccgtgtcatgacctgaagctgcaggtgggcgcctc  c.1141-361

.         .         .         .         .         .           g.25934
ccccttccgtcatggctgtcccccttctgtgaggtgtcccagccgcctgattgccggagt  c.1141-301

.         .         .         .         .         .           g.25994
cccagggtgctcggtgctgtcgtggagcctgggacattcactgtctgggattgattccag  c.1141-241

.         .         .         .         .         .           g.26054
ggttggagccacacctggtctggggcattcgctgtcctgggtcagagcccctcctggtct  c.1141-181

.         .         .         .         .         .           g.26114
gggacattcgctgtctggggttggagccacacctggtctggggcatttgctgtccggggt  c.1141-121

.         .         .         .         .         .           g.26174
cggagcctcacctggtgaagatacagaacatgctgctgccctaaccccgtgtggtgtgcc  c.1141-61

.         .         .         .         .         .           g.26234
ccctgtccccgggtgtcgttcccatagccagcccttgtctcatctcgtctcatcctctag  c.1141-1


Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center