disabled homolog 1 (Drosophila) (DAB1) - downstream reference sequence


         .         .         .         .         .            . g.1257636
tcagaagagggaactaagcatttttggcaaccaatggcagatatctatggcagcacac / aa c.*240

         .         .         .         .         .         .    g.1257696
aaaaagtatagaaagatccacccaacattaaatcagaaatcaagcaaatgcttacccaac    c.*300

         .         .         .         .         .         .    g.1257756
aaatatttgagccctcatagctgggtttaagatgactcagtgtgcaaaattattaattcc    c.*360

         .         .         .         .         .         .    g.1257816
ctttttatttctctacctgttgaccactgttgagacaccaaatttggagtgacaggcatc    c.*420

         .         .         .         .         .         .    g.1257876
agaggattacaacagggttggaactgacttctttaagcaaaagcaaagggtcttctgtga    c.*480

         .         .         .         .         .         .    g.1257936
ccacaatatcgtcatccatatgccttttcacataggatgatgtgttttttgtcactccat    c.*540

         .         .         .         .         .         .    g.1257996
ggggcctggtctgccattttcccccctttcctttttttgtcatgtttgaaaattaatagg    c.*600

         .         .         .         .         .         .    g.1258056
tgtacaaatttttgtattgcttttgactttttttagatatgggtgaagaaatctaactgg    c.*660

         .         .         .         .         .         .    g.1258116
ggagaaaaaaagcctcagtgaaatgaattaacttgaaattacaagacaaataagtggttg    c.*720

         .         .         .         .         .         .    g.1258176
attattcattatgatcacgaatgttgccaaaacagtcctttagctattctgcatcctggt    c.*780

         .         .         .         .         .         .    g.1258236
gaagaaagacagctttcagtacgaaccttcattctgtgagtaggaaaagacatcagatcc    c.*840

         .         .         .         .         .         .    g.1258296
cattgatgagaaagatgaaaaatgcatctgatttcttaagaagctctaaactctaagtac    c.*900

         .         .         .         .         .         .    g.1258356
aataaaatgatattttttatttttccgatatcttgctgctgtgttgctatgcagacaagt    c.*960

         .         .         .         .         .         .    g.1258416
gtcttctccacgtgccattttcaaagaaaagtcatttgccaaataattctggtacaattc    c.*1020

         .         .         .         .         .         .    g.1258476
tggtaatgtggttttggatcttaaaaaccaactttctaatggaacaatggtggcataaat    c.*1080

         .         .         .         .         .         .    g.1258536
attcagaataacaaactgattctgtggtccaaatggttcatctctatctctttttgtaca    c.*1140

         .         .         .         .         .         .    g.1258596
tcagaaaattcaaatgggatttttattttataacttgaaaaaaaaaccttaccattaaac    c.*1200

         .         .         .         .         .         .    g.1258656
tctttaaatatttaagggaaatggctttaaggagttctaatgaaaaaaaattgtcttttt    c.*1260

         .         .         .         .         .         .    g.1258716
tttgtaaatataaatgttaatgaaaatgatttttaataatgccattacactgtagagaag    c.*1320

         .         .         .         .         .         .    g.1258776
gtagcagattgagtgcaaggtgtgacaaacttgatggatggggctcactttccagacgtt    c.*1380

         .         .         .         .         .         .    g.1258836
attctggagcatatggtaggaagctggagtgcagggacagctggcaggagcagttggcca    c.*1440

         .         .         .         .         .         .    g.1258896
atcagcagctagtgaacgggaagggagcacgtgactccatcatctagcctttccacgaga    c.*1500

         .         .         .         .         .         .    g.1258956
gtccccaccctacgtgcaacacaagaaaaagacaattcacattctgaagaattcagattc    c.*1560

         .         .         .         .         .         .    g.1259016
tgaaactctcccacctccccactcccacctacccccgatataaatcactggactgtttgt    c.*1620

         .         .         .         .         .         .    g.1259076
acgtgaaacagaagaggctaagcttcctttttttacacttatgagacaaaaagtgcagtg    c.*1680

         .         .         .         .         .         .    g.1259136
tttggttcgtatgtttagcacatgattttcataaagaatctatatatttttgccctacag    c.*1740

         .         .         .         .         .         .    g.1259196
agaattgttatacaggtcaagtgtgttttcctgatgttcctatgcagttacagtatgttg    c.*1800

         .         .         .         .         .         .    g.1259256
aaagtgttttaacactaagaagaaaactttaaagattcatgtgattaattggatttgagg    c.*1860

         .         .         .         .         .         .    g.1259316
ataattattattatttggtttttagatttgaaaagtagaatttccattgagacaattgat    c.*1920

         .         .         .         .         .         .    g.1259376
ttgaataggcctgcatttgattcttcatatcaatagaaactaaaatgatttgggagattc    c.*1980

         .         .         .         .         .         .    g.1259436
atttgaaaaatgattgtatacttgttcacaaagcgaaaagtgatacatgaaggtaatggt    c.*2040

         .         .         .         .         .         .    g.1259496
tatcatttaaagcccacattttacactatcaggtcacaggagtctaatttttttttcagt    c.*2100

         .         .         .         .         .         .    g.1259556
tagataaactgaccaaacgtctattcaagaatatatgtcaatatcatcctaatgtggaag    c.*2160

         .         .         .         .         .         .    g.1259616
gtccgaagaaccagaaaagtgagaagggccgtttacctccctctgtagctatcacctgtt    c.*2220

         .                                                      g.1259634
ggtccacagagtttcttg                                              c.*2238


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center