disabled homolog 1 (Drosophila) (DAB1) - 460 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.1184078
gtatacctgtgaatttatccttgcgctggagatcgggccttcaaataaacacatgtaaaa  c.558+60

         .         .         .         .         .         .  g.1184138
actgacagtcaggccttctcttcctgctgccaagtagaaataaacgaagatgaaagattc  c.558+120

         .         .         .         .         .         .  g.1184198
ctgtgtaaattacaggacccaaagcaagccattagaaattattccttattctcttaaact  c.558+180

         .         .         .         .         .  g.1184248
ctagacatgttagatgaagtgaaatctcgaatccagagaaagatttcagg  c.558+230

--------------------- middle of intron ---------------------
         g.1184249  .         .         .         .         .           g.1184298
         c.559-230  ggtggaggacccaagaaacacaattgcttttgctgttgttaacagtgcgg  c.559-181

.         .         .         .         .         .           g.1184358
gtggaggtgggagtggctctaaggattttgacttttttgtgttttttctaccttgatggc  c.559-121

.         .         .         .         .         .           g.1184418
ccaccagcctcttctgcccagagctggtttctttactgtcctgtaatttctgaatgcagt  c.559-61

.         .         .         .         .         .           g.1184478
ctcacatctcttcctttatgtcctctgcttttcaccctccctctccttactctgcaatag  c.559-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center