disabled homolog 1 (Drosophila) (DAB1) - 1597 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.1184577
gtaatttctgaaactagtcggggttttagattcaagagtgactagacctgtgccagagcc  c.597+60

         .         .         .         .         .         .  g.1184637
attttgtcagaaacctgaagaatccactgactgcaaaacctggagagagaccaagattat  c.597+120

         .         .         .         .         .         .  g.1184697
ttctgagggtgagggctgccagcccctccaggagcaaatttccataaaaactaacagaag  c.597+180

         .         .         .         .         .         .  g.1184757
tttggccggcatcggtatcttgggatttggagatccgcttctcccttcttgcctctgcct  c.597+240

         .         .         .         .         .         .  g.1184817
cggcccccttcacagtctgtaaaagtttgatcccagagctgaatgttttcaagagtctct  c.597+300

         .         .         .         .         .         .  g.1184877
tgaatattctgagttcattagagagaatatgaataatgaggtggcttctctgagttaaga  c.597+360

         .         .         .         .         .         .  g.1184937
accagaggtgggggctgacattttggtagcattttagcacagacccaaaggatggtttct  c.597+420

         .         .         .         .         .         .  g.1184997
aagctttagaaaggctatgaggaggactctctgacccccgatggggcaagctgaccctcc  c.597+480

         .         .         .         .         .         .  g.1185057
aattacctggctcatgccataggagctgttgggaggaaggaaagagtgaccctaaagaca  c.597+540

         .         .         .         .         .         .  g.1185117
cttctgcccctagctttctctggactctcttcaagatctgcagctcagtggtgggtaggg  c.597+600

         .         .         .         .         .         .  g.1185177
agatgatctctcttgaggtcaagcatgtggtctgttcaaacagagatgcagaaaaaaagg  c.597+660

         .         .         .         .         .         .  g.1185237
gaaaagacagcctctccctcccctgtgcttattcccaaggtgaaaaagaagcccaaaaaa  c.597+720

         .         .         .         .         .         .  g.1185297
tgacttattgaacacaaaggaaaatcttgaacttacacttctaactggatgcataggtgt  c.597+780

         .           g.1185316
tctttgtgtgtgcatgtgt  c.597+799

--------------------- middle of intron ---------------------
                               g.1185317          .           g.1185334
                               c.598-798  gtgtgtgtcacatatgta  c.598-781

.         .         .         .         .         .           g.1185394
ttttatataaatgcttagtttcacacaaaaatctggtactgctacaatgaaagtaaaata  c.598-721

.         .         .         .         .         .           g.1185454
atgtagatgacttgaagtggaaaaatatctcatgtatacggcaaacaaaagccaaagatg  c.598-661

.         .         .         .         .         .           g.1185514
cacgtaatgacgtgctcttgctttagaatgctgagggccgaggatttgtatataatatga  c.598-601

.         .         .         .         .         .           g.1185574
gcttcacccccttgctcactggcttgcacagaatgaagaataatagcctttttgaaatgt  c.598-541

.         .         .         .         .         .           g.1185634
cacagtcccaaaacatgaacttggaaaaatcgatttaatgtatttaaaagtgagaacgca  c.598-481

.         .         .         .         .         .           g.1185694
aaataaggtgatatttatgggataaaggagtttggggcttctgagctcttcagagtttgt  c.598-421

.         .         .         .         .         .           g.1185754
ttaggattttgaaccttagggaaaaagggatgcccctcaactgtaacccatacattacaa  c.598-361

.         .         .         .         .         .           g.1185814
agtttgggatcccaggcattccagtgagatagcattctcactgagcaataccaatgtatt  c.598-301

.         .         .         .         .         .           g.1185874
caggtattactgagacaaattgccattgaatgaagaggttatatctccagaaagatctgc  c.598-241

.         .         .         .         .         .           g.1185934
agaggctcgatgcaatcactgctgaaatactgaccagcagacctctgcagttttccttat  c.598-181

.         .         .         .         .         .           g.1185994
gaaaggcaggaatgtacaaggtacattttatttcaataatttagttgtgtctttaaggtg  c.598-121

.         .         .         .         .         .           g.1186054
ttttctcttgtgcctgcttcgttaatgctcgctgtgatttgtatcttaatttccaaatgc  c.598-61

.         .         .         .         .         .           g.1186114
ttgttttacctttcttctttttcacctctgacctttcctttctggctgctcctgtaatag  c.598-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center