disabled homolog 1 (Drosophila) (DAB1) - 6416 nt intron 10 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.1186240
gtataaaattgcttgcctctcttaccattgcaccactactagtacatgcataaatgtact  c.663+60

         .         .         .         .         .         .  g.1186300
gatagtctaaagaaccaagggttctgttggtcattcctggcttgttaaaatacctttgag  c.663+120

         .         .         .         .         .         .  g.1186360
tgaaatggcttctagttccccagcaatttaccagtagttttcatgccttgttgttgatgt  c.663+180

         .         .         .         .         .         .  g.1186420
ttaatagctagttaggtacagtgttttacttttgaatggatcttaactattttaagtaga  c.663+240

         .         .         .         .         .         .  g.1186480
aacaaaaataaaatgttccattttactaaagtaatacattggagagctggtgtccattat  c.663+300

         .         .         .         .         .         .  g.1186540
acaattagggtcctttatttctcaaaagaatgtgcttatcaaatttcttaaaaagccaac  c.663+360

         .         .         .         .         .         .  g.1186600
tccgctactgaaaataaagcacaaatttaatttcaaatgatgtgtgaaaacaacattgag  c.663+420

         .         .         .         .         .         .  g.1186660
aatattaactgaatgaaagtacagctaaaggctttacccttattttaattgtgcaaagaa  c.663+480

         .         .         .         .         .         .  g.1186720
aactgaactttttaaactcactgaattctcatgaagatgttataaactagatattttaat  c.663+540

         .         .         .         .         .         .  g.1186780
tctgtttttatagggtgagactcagagagagaagccgagtagctttctcggggttgtaca  c.663+600

         .         .         .         .         .         .  g.1186840
actatttagagccaagattcaaacccaggcatgggtgtgaaggcgaagctctgcctcctt  c.663+660

         .         .         .         .         .         .  g.1186900
ctgccatggtcttccaccaaagtgtctgtgtaactgccgtatagcagcacatcaaataga  c.663+720

         .         .         .         .         .         .  g.1186960
tatgatgacctgcaacttttcactcattagtattgtagtcccaatttgaaatagaaacat  c.663+780

         .         .         .         .         .         .  g.1187020
tataggggaagaaaaaaaatttgatgtatttaataagtgattttaattttgttagttgtg  c.663+840

         .         .         .         .         .         .  g.1187080
tggcctattctgccttgggtgtgtattacttgtgtaataaaagtaaaacatattttcaat  c.663+900

         .         .         .         .         .         .  g.1187140
ttctgtcaaatgcatagaattctaaatgactaaaatataatgttagttctaccaacaact  c.663+960

         .         .         .         .         .         .  g.1187200
ttgtttaaagttgtcagccttgttgaataatattttctctccactggatctatctggatt  c.663+1020

         .         .         .         .         .         .  g.1187260
ccattcaaatgtgaggttgtgctttgagacttttttcaaagttgtggcttaccaagtatc  c.663+1080

         .         .         .         .         .         .  g.1187320
tttaataagaaaagttgcgtttgtcctgagtgtcagattttaaagtatatacaaccttac  c.663+1140

         .         .         .         .         .         .  g.1187380
agtatctgaatatgaggaggaaaaaaccattaaccaatcatcctaagaagagagggcccc  c.663+1200

         .         .         .         .         .         .  g.1187440
ttttaaataaaaggaagctttgcagtattacaggtttctgaatccagacttagctatagt  c.663+1260

         .         .         .         .         .         .  g.1187500
tggcagggctcccattgagccttgtaggattgcagtgggggcggggtggggagggagaca  c.663+1320

         .         .         .         .         .         .  g.1187560
tcctagtgtactggaaagacctgctttagctggtggaaagctgggttgtagtccaggctc  c.663+1380

         .         .         .         .         .         .  g.1187620
tcttaccaactacctttggctaagtggtagtgggcaaggcacttaccttctcagagtcag  c.663+1440

         .         .         .         .         .         .  g.1187680
tttctcccttgataaaataagcgaacaattgttccctaactcacaagctcatgtgtagaa  c.663+1500

         .         .         .         .         .         .  g.1187740
tggaaagaagaggtgtcatcatgggtcacaaaatgtggagtctggctgtgtggattcagt  c.663+1560

         .         .         .         .         .         .  g.1187800
attttagtacaagtatcaactcagccattaatttaactgtcaagtatttttttttcctct  c.663+1620

         .         .         .         .         .         .  g.1187860
gggcttcagtttactcatctgtaaaatgagcaagtaaaatacagggctctctcaggcaag  c.663+1680

         .         .         .         .         .         .  g.1187920
acccttttctgttttttgcaattaccactttaccataggactttgatttttttagagaag  c.663+1740

         .         .         .         .         .         .  g.1187980
caggttagcttgttttacaggataataagactcagaaatggtggaggtgggaaaatttgc  c.663+1800

         .         .         .         .         .         .  g.1188040
gtgtgcacatgcgctgatggtgagccaactctgttaatggggtttaagtgcaatatctta  c.663+1860

         .         .         .         .         .         .  g.1188100
tctctcacaacaaccccatgtggcttgaatcattattcccaccttacagataaggaaagt  c.663+1920

         .         .         .         .         .         .  g.1188160
gaggctcacagtgataaggtaacttgcccagggtcccagagctagcaataggtagagccc  c.663+1980

         .         .         .         .         .         .  g.1188220
ccactgcaggtccctctgacctctgtaaataaagaaataaatcctaaggctgctctcagc  c.663+2040

         .         .         .         .         .         .  g.1188280
tcagaatcccctgattctgagtttcacaattcgattctaagtccctttcaagtcactatc  c.663+2100

         .         .         .         .         .         .  g.1188340
taaaaatcacacttgttttaacagctctgacctctagatcttcccatctgtccatcatta  c.663+2160

         .         .         .         .         .         .  g.1188400
acaggaagctaccatttaagggaatgagtattttatctccttctattggaaaggcctttg  c.663+2220

         .         .         .         .         .         .  g.1188460
gtcattctcttctcctgctctgccagtctgctggggctcaatttacttaataagagataa  c.663+2280

         .         .         .         .         .         .  g.1188520
gctcttgggcctgaagataaggctgggcttttaaggggctgctattaggcgcctcatttt  c.663+2340

         .         .         .         .         .         .  g.1188580
ttttttaagggcttgtaagtgttccatagctatttctcctgaattgcagtgtttgttagt  c.663+2400

         .         .         .         .         .         .  g.1188640
acttcagcttggcccagccagtggtctcagcttttattcacctccttgctttctgcagtg  c.663+2460

         .         .         .         .         .         .  g.1188700
aggcagacagtcctggagacctttaactcttttgtgaacttaagtggagaacataatttt  c.663+2520

         .         .         .         .         .         .  g.1188760
tgtatctcaatttcctgggctatgaaatggggataatatattctctgctcctagcagtga  c.663+2580

         .         .         .         .         .         .  g.1188820
tgtgaaaacgtaaaacgaggaggagagcagttggttcatagtaggttctgtgtaaacgtg  c.663+2640

         .         .         .         .         .         .  g.1188880
agtttcccctccttccttgcgtgttgtcagtttcagatgctgttgaagatgtcttatgat  c.663+2700

         .         .         .         .         .         .  g.1188940
catgttttaagtgaaatagaacataacttgctcaccacatgttgttggagagcctagcag  c.663+2760

         .         .         .         .         .         .  g.1189000
aaatcctcaagcgtgcttcactttcctatttataactccaacaaaagggatacagaggct  c.663+2820

         .         .         .         .         .         .  g.1189060
tttgagtaaatgtaacctcttttttcgaggtttttctaatagtcttgttttcccagctat  c.663+2880

         .         .         .         .         .         .  g.1189120
attaataataataattgccttttgctttgcatgcctcagaaaaagttatcggctgtgttg  c.663+2940

         .         .         .         .         .         .  g.1189180
aagttatcagcctcccaatacaaaacatttttacacatcacttaattttgatccttccaa  c.663+3000

         .         .         .         .         .         .  g.1189240
taatggtgacataggaaaaacagctacaatgactatcattttgaacataagaaaatcaag  c.663+3060

         .         .         .         .         .         .  g.1189300
ttcccccaattgaggtgctgaatacaaggtcagaacctctgattctaaatctagtgttct  c.663+3120

         .         .         .         .         .         .  g.1189360
tcaatgcctgaacaggcttcctatataagcaagatttcagctttccacatggtcattttc  c.663+3180

         .         .          g.1189388
caagttcattcattcaaaaactactgtt  c.663+3208

--------------------- middle of intron ---------------------
                    g.1189389           .         .           g.1189416
                    c.664-3208  aaccatccaatccttgtcaagtatcgtt  c.664-3181

.         .         .         .         .         .           g.1189476
atttttaaatgatgagtctccaggaaatgttacccaacaaagcctggaactgcctctcca  c.664-3121

.         .         .         .         .         .           g.1189536
cactattaattaacatgctgccaaaataaaagtaaaagtgtcttctgtatgtatagtacg  c.664-3061

.         .         .         .         .         .           g.1189596
gaatgtgctgtttttagagtaatttaacatctattcacttacacacaaaaaaaagattat  c.664-3001

.         .         .         .         .         .           g.1189656
ttatagaacaaataaatgactggacactgggaaatcacatgcgtctggcacggggatgag  c.664-2941

.         .         .         .         .         .           g.1189716
atggtgaccatggcacagccctcaccctcagaaatttatgtatagcccccttagatgctc  c.664-2881

.         .         .         .         .         .           g.1189776
acaatgggcagatggggcaactgaagttcagagagcaaagcgactgtctgagtcgcagcc  c.664-2821

.         .         .         .         .         .           g.1189836
tgtggcagacccaggatttggaactaccagtcttctggttccttttggtctgaaactttt  c.664-2761

.         .         .         .         .         .           g.1189896
atgtctctaaaacattgtgttactgaagccttttgtgtaaacagaatggtacagctaagc  c.664-2701

.         .         .         .         .         .           g.1189956
agagatgagagccaggaccatgcaccttagcactcatgggctgaatgcttggcgattagg  c.664-2641

.         .         .         .         .         .           g.1190016
catttctttgtttcaccaatatttatagctgtggatacaaggataataaaataccccaac  c.664-2581

.         .         .         .         .         .           g.1190076
ctgccctcagcaagcttatagaccctggaacagttacaatgtgatgcaataattctcatg  c.664-2521

.         .         .         .         .         .           g.1190136
ataagataaagcacactttacactctatttcagtagtctgattacttttccatctccccc  c.664-2461

.         .         .         .         .         .           g.1190196
aataagacaaggagctctgttaaatcaggggccatatccatcatgttcaccatcactgtc  c.664-2401

.         .         .         .         .         .           g.1190256
ccagggaacgcgtgatgcatgacacataatacgtgcttagcaatttttattttttaatga  c.664-2341

.         .         .         .         .         .           g.1190316
aagaatgcaccagaggttaccagaatacaggggaaggctccaaacaaggcctagagaatc  c.664-2281

.         .         .         .         .         .           g.1190376
aagtgaggcttccaagaagatatcccagctgagataaatcttaaaggacaaacaggcaga  c.664-2221

.         .         .         .         .         .           g.1190436
ttgatatctcacccatgggagagccaagtagaaaagcgttttcaattatgcacagtttga  c.664-2161

.         .         .         .         .         .           g.1190496
gtttatccattccactgctttttctccatttttagggataattgagaggcagctgcggtt  c.664-2101

.         .         .         .         .         .           g.1190556
caactgtgctaagtgcccgtagtgagcagtgaattacgggcaacagaatgttcttcattt  c.664-2041

.         .         .         .         .         .           g.1190616
ttctcagtaaaggttgagctagtaaaaacaaaagtgagggctggtaatttattggccctc  c.664-1981

.         .         .         .         .         .           g.1190676
attaacaaggactctgtaggcattcttagaggatttcttttagatggagctcagttatca  c.664-1921

.         .         .         .         .         .           g.1190736
ggagcaaagaaacgacattcttcactggctacttgcacagtgaagcttgcaagatcagct  c.664-1861

.         .         .         .         .         .           g.1190796
ctggaagtgtaccactgacacggccatgctcactcagtcctgttttctgcaagagtgtag  c.664-1801

.         .         .         .         .         .           g.1190856
atgagcttctgggaacataggatgtgatgtcaaagaaaaggcccacttgaaacaactgtc  c.664-1741

.         .         .         .         .         .           g.1190916
tgaatagtatagcagtcaaatggcaaactccctgggctcaagcttttggcttccccattc  c.664-1681

.         .         .         .         .         .           g.1190976
acagactgcactcatggagtgagttgaatcacacaaactactctgtccaagggcctcaag  c.664-1621

.         .         .         .         .         .           g.1191036
gtcacaggtgttctagggcaaatatctctactgccagagatatttttctcctctgcaaca  c.664-1561

.         .         .         .         .         .           g.1191096
tggggccaactgagttcttacctgaaagacttgtcttgaggattgcatgagaatgtatgt  c.664-1501

.         .         .         .         .         .           g.1191156
aagacacaaatgtttagaacagcgcctggcacataggaagcacccagtccatgttagctc  c.664-1441

.         .         .         .         .         .           g.1191216
acattattaataatagatgtcttgtttggccaccagaaagagctgggtttgaacctggtc  c.664-1381

.         .         .         .         .         .           g.1191276
acttaccagctttgacgatttgggcaaagtccctaacatctctgagcgtcactttctcct  c.664-1321

.         .         .         .         .         .           g.1191336
atttaaagtagagatgatactaccaatttcttagagttattgcaaagattttaagttaaa  c.664-1261

.         .         .         .         .         .           g.1191396
tgagatgaaaaatgtcaaaggacctaaggaataagctcaaattcttacttcttatagaac  c.664-1201

.         .         .         .         .         .           g.1191456
aatggtgtagttagctagctcaagcccaaaagatacttttccttcactattccccacatt  c.664-1141

.         .         .         .         .         .           g.1191516
cctctatcatacgtttaccatatgtctcagcagacatttactgagagcctactgggtgtt  c.664-1081

.         .         .         .         .         .           g.1191576
aggcactatgcctgctcttgaggagctcccaatatgatggaaagaaaggcatgttgtcag  c.664-1021

.         .         .         .         .         .           g.1191636
accattataaaaccactgctggctgggtcctgcaatgggggtgtgagctaagctgtgaca  c.664-961

.         .         .         .         .         .           g.1191696
gttcctgggaaaggaacaactaatgggtgcttccaatctggaatctttcagtgaaaaccc  c.664-901

.         .         .         .         .         .           g.1191756
ttggttgactcatttgaaaagtagtcaacatatccactatcgttagtatcataagatgtg  c.664-841

.         .         .         .         .         .           g.1191816
ttcgtatatatttaaatgatgtgtcagtaactaaagtaattcttctaacacattacagta  c.664-781

.         .         .         .         .         .           g.1191876
ttatggtatgtaatagtgttgtgtatctaatatccattttcttactccatcctcagaata  c.664-721

.         .         .         .         .         .           g.1191936
acctgagtaagaggcagagctgatagtagtgaagctcagagctcagtgacctgctcagcc  c.664-661

.         .         .         .         .         .           g.1191996
tgtcacagttagctcataacagtgagaccagatggatgagtaagggaagggaggaagatg  c.664-601

.         .         .         .         .         .           g.1192056
cagattaatgttaaacgccctcaagatcttctgcgtactaggcccacactttccatacca  c.664-541

.         .         .         .         .         .           g.1192116
ctcgtgggcctttttcttcaatgaaaaccttccataattatcaaatggcttgtatctgat  c.664-481

.         .         .         .         .         .           g.1192176
cccagtagaagctgtgctttgtgctaggatcttgatatttgctatattttaaatagccca  c.664-421

.         .         .         .         .         .           g.1192236
gatctcagcctcagcattgaacagtttaagctcagctgcaaactgtttttaatcacttca  c.664-361

.         .         .         .         .         .           g.1192296
ggaacagtatagcacctccctacgcctcatttttgtctaaggaaatgaggattttttttt  c.664-301

.         .         .         .         .         .           g.1192356
tttaccgcatgacttctgaagtctatgtaagtttctagtctttgattctgcgagaagccc  c.664-241

.         .         .         .         .         .           g.1192416
aatggcagagacgacctataaacctttgttaaatgatgcccactccctgtccccatctga  c.664-181

.         .         .         .         .         .           g.1192476
tgctcctaagggagggagcctggcttgatactttcacaattagagcaggttcccatgggc  c.664-121

.         .         .         .         .         .           g.1192536
ttgtccctggggccattctcaggcacccttagccagcttgcagttgaagtctggttgctt  c.664-61

.         .         .         .         .         .           g.1192596
tgttctttgaaattggagtaccagagtgttttgactgtgctgaatttaatttttccatag  c.664-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center