disabled homolog 1 (Drosophila) (DAB1) - 2341 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.1229619
gtaagtatgcattgctctctgaaccctgctctctgaattcctttctttacacatcccctc  c.786+60

         .         .         .         .         .         .  g.1229679
agtggccagaatatgggctttgagtgaaagagggctgctggtggatttcagtgttgactc  c.786+120

         .         .         .         .         .         .  g.1229739
tttcaagctgtgtgacttggacaaactaactagtcattctgatccttaatttgcttggct  c.786+180

         .         .         .         .         .         .  g.1229799
atttataaaggggaagtatgatatatgcctctgttttgagaaataaacgagaccatgcat  c.786+240

         .         .         .         .         .         .  g.1229859
ttagcaatgacaggacttgcctgggtgcttgctgttctgctgtggtctgagaagaaaggc  c.786+300

         .         .         .         .         .         .  g.1229919
ccgaaggagatgtgcttcctgactacaaggggcacatcgtctggttgggattgtaggcag  c.786+360

         .         .         .         .         .         .  g.1229979
gaaactcgggatagcacatatgatgaggcatttgtcagcacctgccccaagcccagtaca  c.786+420

         .         .         .         .         .         .  g.1230039
gcataggtggtcagcccagtaaaggaaggatcttctccccacaccctgctctgcccatcc  c.786+480

         .         .         .         .         .         .  g.1230099
ttctctcctttccctctttctttcctctctccctcctttttgtttcttccctcccttcca  c.786+540

         .         .         .         .         .         .  g.1230159
gcctgcccttcagctttgcagaccatgacctgggcctcactgagcttctcaagaagctct  c.786+600

         .         .         .         .         .         .  g.1230219
ggattcccagccacagcttcagccagtgtacctcagtcagtgcttacaaaaggacagaga  c.786+660

         .         .         .         .         .         .  g.1230279
ttgcagggagaacctaatttgaaaacgaaaagaagaaaacagaattaacaccaaagcaaa  c.786+720

         .         .         .         .         .         .  g.1230339
acagaatcccagtgctggatgcattcaaaagcaattctgccaccactgcaaagaaaagag  c.786+780

         .         .         .         .         .         .  g.1230399
ccgagatggcccctccagcccctcccctgcccattcccggaggagggcagagagcagtca  c.786+840

         .         .         .         .         .         .  g.1230459
gccgcagctgcaccagctgaagctgccgggaggggacagctcctctgggcactgcgcagt  c.786+900

         .         .         .         .         .         .  g.1230519
tgtgcaaaccgagggatggtgctatggttcattggcaagatgcgcctcacagagaaaagg  c.786+960

         .         .         .         .         .         .  g.1230579
ctgtaacctcaccactgaggacagatggcacaagacactgctgcccactgctgccaccag  c.786+1020

         .         .         .         .         .         .  g.1230639
ggaatctaggcacagctgccctgctgccaacacctgatgtccaaggcagccttgagggag  c.786+1080

         .         .         .         .         .         .  g.1230699
gggactgcagcctctgtccccaaagaagctggatggctctagcgattgtcattctaccct  c.786+1140

         .         .         .   g.1230730
ttatcctgggctaaaagcttcttcctgggaa  c.786+1171

--------------------- middle of intron ---------------------
                  g.1230731   .         .         .           g.1230760
                  c.787-1170  cttggagttgcagaacggcagggctatgca  c.787-1141

.         .         .         .         .         .           g.1230820
gctagaaagggttgaagagatcttctaaccttatccccttcattttacagatgagcaaac  c.787-1081

.         .         .         .         .         .           g.1230880
tgagtcccagagaggacatgtgactcacccaaggtcacaaaggggaaagaaagaacagca  c.787-1021

.         .         .         .         .         .           g.1230940
ctgactgtgtttaaaagtgcttaacacagcagctcatggctgtgtttctggccctgaacc  c.787-961

.         .         .         .         .         .           g.1231000
caagcgcagtccaaatgggtatttaataatcctcagaacaatgccattcgtcctgcaagc  c.787-901

.         .         .         .         .         .           g.1231060
tgctagtctaaaaatggccttgtctaattgccatgatttcaggattaattgcttgcccca  c.787-841

.         .         .         .         .         .           g.1231120
gcctattccaaggggaaaaaaaaggatattacagcatcgaacagatttacactctgtagg  c.787-781

.         .         .         .         .         .           g.1231180
caaaagcctgctataaatgggtgtggacatatacaaaattatgagtactgatgttttcat  c.787-721

.         .         .         .         .         .           g.1231240
ttctgtatcccccatcttgcccaccagtccatgcagcagacctttttggaattccagcac  c.787-661

.         .         .         .         .         .           g.1231300
cgactaggccctgtagaattttcagtggtgcaagcattgtttcttgttgtcttcttgaaa  c.787-601

.         .         .         .         .         .           g.1231360
atatttacttctttttgcaaatgaagattcaggcaaaatctggggcgctgacggggggtg  c.787-541

.         .         .         .         .         .           g.1231420
tggcgggggggcaccaggatacaagggtctgtgcaccacttgctaaattttgtgtgttga  c.787-481

.         .         .         .         .         .           g.1231480
tttagtcaacaactgctcattgaccgtgtattaaattgcaacccctgagctgggcacaca  c.787-421

.         .         .         .         .         .           g.1231540
gtaggtcttgagtgggtgtatttcagtttgagttggccacctctaaagggtgagtgccaa  c.787-361

.         .         .         .         .         .           g.1231600
atattatggaaaatttgatacctgaaaacaccccccagggagtaggggctcaaactaaat  c.787-301

.         .         .         .         .         .           g.1231660
cattaggatactggccattatttgccaagcacctactacatgcctatgcacggtgctaaa  c.787-241

.         .         .         .         .         .           g.1231720
aatttaagtaatgtaaaataatttaattacataatctcacttaatcctcacagtagctct  c.787-181

.         .         .         .         .         .           g.1231780
ggaggtgtcatttcccatatagataaagtgtatgtaaccagcacatgggctgcacacccc  c.787-121

.         .         .         .         .         .           g.1231840
ataagtggcttgaactgtggaccccttcccctgcgccttaattcctgcatctgctacctc  c.787-61

.         .         .         .         .         .           g.1231900
ccagccttgatgactgctaagccaggtctcatgtgtcctctgcctctctctgtctggcag  c.787-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center