disabled homolog 1 (Drosophila) (DAB1) - 8099 nt intron 13 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.1232069
gtaagccctcttccaccagcttcccttcctttggccttcactcattaagagagagaaaga  c.895+60

         .         .         .         .         .         .  g.1232129
gtttacagagccagccaccgaatgatgataaaacactgctgttctctcctgtgactcttc  c.895+120

         .         .         .         .         .         .  g.1232189
aggtgacattgagaagctatttagaggaggaggtggtgttggggtccagagctctgggat  c.895+180

         .         .         .         .         .         .  g.1232249
gttactggcctggaattcactgatgtctttcacccagacagctcaagattctatgttact  c.895+240

         .         .         .         .         .         .  g.1232309
caggtgtgcagcttttgggagcatggcatatgcacagctgtgcaattagcccaagtccat  c.895+300

         .         .         .         .         .         .  g.1232369
ttccactcttccacctctgccaggagagaaagcaataagcaggggaggacacggagtcag  c.895+360

         .         .         .         .         .         .  g.1232429
ctttctatagacttcttgagacctgatggatagaaggggtctgccttacttggtgctgac  c.895+420

         .         .         .         .         .         .  g.1232489
tcaaggaaagggaaggtccccagacaaagtggggagcaccctatgggacaagagcaaact  c.895+480

         .         .         .         .         .         .  g.1232549
gctaactgagttgtgagaataatgagactcctggtgagttagaaagtatgtgttctgttt  c.895+540

         .         .         .         .         .         .  g.1232609
ttcaaatagtctttaaatgtatttactacttttacaacaagttaaaaaaatatatagtgg  c.895+600

         .         .         .         .         .         .  g.1232669
cagtattgcaggtgagttacaaatggatggagcccagcaatcttaccttgtttccatggc  c.895+660

         .         .         .         .         .         .  g.1232729
atgaggcgttccatgtggccaggccactgtacttgcaaatagccaaaggtagtttagttc  c.895+720

         .         .         .         .         .         .  g.1232789
tgtttttgacatacatgggagccttaaagggttttgtggttttctttaactatgtatttg  c.895+780

         .         .         .         .         .         .  g.1232849
aaatctgtggctttatctttcttgcctttattcttataaatggcaaatagagttgtttga  c.895+840

         .         .         .         .         .         .  g.1232909
atattttagaataccaatcttcttgcatttttttctataattacttttaattacatactg  c.895+900

         .         .         .         .         .         .  g.1232969
ttagaagcaaattcttgccaccaaatataaactgtgcttttattcaaagtaaattaaaaa  c.895+960

         .         .         .         .         .         .  g.1233029
tgcataccctgttctaaaatagttacggttattactcatgagctaagggatcattatgaa  c.895+1020

         .         .         .         .         .         .  g.1233089
cttttagaagcaatagaggttggtaacccttggatctaacttacagtttagactgcaaat  c.895+1080

         .         .         .         .         .         .  g.1233149
tgcctagaaatgtattcaattgtgaagtttcccaatctaatctttaaaaagggatagtga  c.895+1140

         .         .         .         .         .         .  g.1233209
tgatgactagttttccttacctaaaatagatattaaaatatccatgggactactataatg  c.895+1200

         .         .         .         .         .         .  g.1233269
gcacatgccattttaaataagagtaagagttttccatcagaaatgcaccacccttctatg  c.895+1260

         .         .         .         .         .         .  g.1233329
cttgagtcttgtgttcggagtgcccatgctttgtcctcattgttttatctgtaaagggta  c.895+1320

         .         .         .         .         .         .  g.1233389
tgctgggacagatgatggccccaaacttacaaatttgcaggcatgttcatttcaaaaatg  c.895+1380

         .         .         .         .         .         .  g.1233449
ctcaccaggtgccctctatgttccaggtcctgtgtaggtgcttgggatgtgctagtccac  c.895+1440

         .         .         .         .         .         .  g.1233509
acaacagacagagagcctaccttttactgggaagacaggaaataacataaaaataagtaa  c.895+1500

         .         .         .         .         .         .  g.1233569
tttgcataatatatttaaaaatgagaagtgatagggacaaaagaaaatgcagaccagagc  c.895+1560

         .         .         .         .         .         .  g.1233629
atgggggcttttgagtgcaggcagagggcaggtgtaagtggagcccctgtagtcacgagg  c.895+1620

         .         .         .         .         .         .  g.1233689
ggctcttgcctaggtgacatgtgacaggactagcagggacaggaaagtctcaagtaggca  c.895+1680

         .         .         .         .         .         .  g.1233749
tcagagttccaggtactccaggcagaggaatgacttggtcccccaagtctccattccctt  c.895+1740

         .         .         .         .         .         .  g.1233809
ctctataattgagaagatgggactagatgcaattttatatctcttccagccctaacattt  c.895+1800

         .         .         .         .         .         .  g.1233869
gattaaaaacacgctgaggacctgcctgggtgtattagtccattctcacgctgctgataa  c.895+1860

         .         .         .         .         .         .  g.1233929
agacatacctgacaccgggtaatttacaaaggaaggagttttaatggactcactgttcca  c.895+1920

         .         .         .         .         .         .  g.1233989
catggctgggtaggcctcacaatcatggtggaagaaaaaggaggagcaaaggaatgtctt  c.895+1980

         .         .         .         .         .         .  g.1234049
acatggtggcagacaagagggcttgtgttcaggggaactcccctttataaaaccatcaga  c.895+2040

         .         .         .         .         .         .  g.1234109
tctcatgagacttactcactaccatgagaacggtgtggggaaaaccacccccatgattca  c.895+2100

         .         .         .         .         .         .  g.1234169
tttatctccacatggggattattacaattcaaggtgagatttgggtggggacacagccaa  c.895+2160

         .         .         .         .         .         .  g.1234229
accatatcactgggtcagtcacagcactgctctgggccctctttcaaacctgtaccagat  c.895+2220

         .         .         .         .         .         .  g.1234289
tagggacttggaagacctgggttttagtcttgctgcttaaccagccacattggaagctat  c.895+2280

         .         .         .         .         .         .  g.1234349
ggacaagccacttccacatatccagatttcctttctttagctgctaaaattttgatagat  c.895+2340

         .         .         .         .         .         .  g.1234409
tacctccaagatttcaacttttagaacacgagtctaaaattaatttcaattagcatgttt  c.895+2400

         .         .         .         .         .         .  g.1234469
ttgctttctgactctagttaatatgacagaactggcttcagttggtgttaaactgtgtgc  c.895+2460

         .         .         .         .         .         .  g.1234529
cctatttctcccttaactggccataaaaatttctgtagctattgaatcccgatctccttg  c.895+2520

         .         .         .         .         .         .  g.1234589
tgactaattgtccagccagtgataaggagacagggaagtgaactggagtatgtgatacaa  c.895+2580

         .         .         .         .         .         .  g.1234649
cggatggactggctcctgggggcttttgaatctaatgggccaggtttggatcctgattca  c.895+2640

         .         .         .         .         .         .  g.1234709
gccattatttctaagctttagactcctgggcaaattacttgacctgtcagagtcagagtt  c.895+2700

         .         .         .         .         .         .  g.1234769
tcttcatctttataactgagtgtaaaataatacttactttgcaacaatatcaagagaatt  c.895+2760

         .         .         .         .         .         .  g.1234829
aaatgaatcactacattaactgcagctgtagaagtggtatcactacacactgaaaaatgc  c.895+2820

         .         .         .         .         .         .  g.1234889
tggcacatcatcaatatttagtgtagaatatgctgtattattatgattactctgatttct  c.895+2880

         .         .         .         .         .         .  g.1234949
acagtagatgaatatatgtcctgttctacctatattttttcctttacctggaaattagtg  c.895+2940

         .         .         .         .         .         .  g.1235009
cctgtaataaagtttaggtcttcagcctcttgactgcttatagcagacagcaggagaatg  c.895+3000

         .         .         .         .         .         .  g.1235069
ggtggcctggagaatgtactatgtatgaacacaagctctgccactagccagctgcaccat  c.895+3060

         .         .         .         .         .         .  g.1235129
actcagataaatatcttctgagcctcagggaacttaccccgttttaatggggatgatcat  c.895+3120

         .         .         .         .         .         .  g.1235189
aattctacctcatagagtttttctaaggattgcatgagtaaatgcacattgtaaaatagg  c.895+3180

         .         .         .         .         .         .  g.1235249
tacaacagttcctggcagtgcttccatcagtaagcactcaacagatgtttgctacatggt  c.895+3240

         .         .         .         .         .         .  g.1235309
tcttcaggagccttggatctgctattcatacagtgtgtagctgcatcaaatctttccctc  c.895+3300

         .         .         .         .         .         .  g.1235369
atggagttgcaatttctcctatacaaattaaagagatagcaatcacactcaccccagagg  c.895+3360

         .         .         .         .         .         .  g.1235429
cttgtggaaaggatcaccttcacaaaaatgtaagctgcacagggtaagaatttttttttt  c.895+3420

         .         .         .         .         .         .  g.1235489
tggtgactgttttgttctttgttttgtctccacacactaaagcagtgattggcacctagt  c.895+3480

         .         .         .         .         .         .  g.1235549
ggaggtatttttgaatgaatgaatccatcaaatgagataatgtagataagagatgtcata  c.895+3540

         .         .         .         .         .         .  g.1235609
caagttctgtataaatgttggaggagttccttcgtttttagtgcttttcttatatttcag  c.895+3600

         .         .         .         .         .         .  g.1235669
tctgcctttttttcttttttcaaataatgggggcatccccaggtgtcagcatctggctgt  c.895+3660

         .         .         .         .         .         .  g.1235729
aaatcacaattttcaacactttttaaaaacctaactgtaaggcagcaaggcaggtgttcc  c.895+3720

         .         .         .         .         .         .  g.1235789
ctttcactccacagcaaggagatttatgattgctctgaacttcacggcataaacagatgc  c.895+3780

         .         .         .         .         .         .  g.1235849
tccttagtacctcctccctccactattggacattaattgtaaacagttaacaagctgtta  c.895+3840

         .         .         .         .         .         .  g.1235909
agtggctgcagtggcagccaccaagtggctccctctgtccagtgccaccactgtcctgct  c.895+3900

         .         .         .         .         .         .  g.1235969
gctgacgtgtcccttcgctcatgcacaagaccatgtggccagacagccttaactcacagg  c.895+3960

         .         .         .         .         .         .  g.1236029
ccgaggagagccagcctgcagggaacccctaggaaaagtgagtgggacctgcaggctcct  c.895+4020

         .         .         .  g.1236059
aaacatgatacccaattaccctgtgctgcc  c.895+4050

--------------------- middle of intron ---------------------
                   g.1236060            .         .           g.1236088
                   c.896-4049  ttttttcttttgaatattgtactttggtc  c.896-4021

.         .         .         .         .         .           g.1236148
tggagcagatggcatgaagccagagagacatgctaatagctctctccagaaaagtgtgca  c.896-3961

.         .         .         .         .         .           g.1236208
cagcccatctgttagctccttgtggaaaaaaaataaaagatgggaggggaaaaaaaacct  c.896-3901

.         .         .         .         .         .           g.1236268
gccaccaacagtagaatcatcagagatcacagcacttatgcattgtgggtttaattagac  c.896-3841

.         .         .         .         .         .           g.1236328
accgggaaaaatgcagtgaatgtattgactaggactcatttacctttatgtagggccttt  c.896-3781

.         .         .         .         .         .           g.1236388
ctcccgtcccaaaccatgctaggcagggtggaaagagagagagaataaagagttcctgcc  c.896-3721

.         .         .         .         .         .           g.1236448
agcaggtggtttctagtctcatcagggaagatagaacaaccaggcaattgcaaggcagtg  c.896-3661

.         .         .         .         .         .           g.1236508
tgacaagtgtcatgatagaggtgagcacagggtactgtggaagcccagagaaggaccagt  c.896-3601

.         .         .         .         .         .           g.1236568
ggtgctgacaggagcaagaagccatccaacagaggtgatagtgaactgagtctccaagag  c.896-3541

.         .         .         .         .         .           g.1236628
caaatcagggttagacagcacagaagcagggggatggctttccaggcagatgggccagca  c.896-3481

.         .         .         .         .         .           g.1236688
gagacaagagacagcaggttgggttttgtttgcaaatgctggagggcaaggtgcagtgag  c.896-3421

.         .         .         .         .         .           g.1236748
gatatggattgaagatagtgatgaagaggtggaaggagctgacccccaaggacgcatagc  c.896-3361

.         .         .         .         .         .           g.1236808
caagctaagacatctgagccttatacttaagacaatgaagtaccatatatgcatttaaaa  c.896-3301

.         .         .         .         .         .           g.1236868
acagtccttcatggcagcaaggagggtggaataaaagcaaagccaaaaacaggctgatgt  c.896-3241

.         .         .         .         .         .           g.1236928
caagagagtgaaaacatccactcattcaccaaaatgggcatcaggtcttgggtgattgaa  c.896-3181

.         .         .         .         .         .           g.1236988
tctgtgggtagttctccacctgcagacccagcacccccttcttattacaaatatttgcaa  c.896-3121

.         .         .         .         .         .           g.1237048
tacctcctttcacaccttgaaatgaatttcatagataatgtagtctagctacacaatttt  c.896-3061

.         .         .         .         .         .           g.1237108
tcaaaatgaatataattctctaactgtagtataaggcagaaagaaaagaaagagaacttg  c.896-3001

.         .         .         .         .         .           g.1237168
taataaaaatatatgtatttaaataaggaaatactcaggcgtgagcacactagaagacat  c.896-2941

.         .         .         .         .         .           g.1237228
aagagtcagatgtatatacctgtaagtagaatcactactgaaagccacagctgtaagtcc  c.896-2881

.         .         .         .         .         .           g.1237288
aggctaatacagaagtgtcatgtggctacaccaccatgagaagcgcttctgtcagggatg  c.896-2821

.         .         .         .         .         .           g.1237348
tcaggcactgccattttccaaaatagtgaacaccttttgacagtgttccaaaccaaaaat  c.896-2761

.         .         .         .         .         .           g.1237408
acagtcttctctcctgtgcacagttgttgaattcctggaaaattaaatgcattaaaatca  c.896-2701

.         .         .         .         .         .           g.1237468
aatgcaaagataactgaatttccatgtaattcaaagtcgattctaggtgcaaatgatcat  c.896-2641

.         .         .         .         .         .           g.1237528
aaacaggatgtggaataatgctttgtcgtacgcattggtctcagacataataggatgtct  c.896-2581

.         .         .         .         .         .           g.1237588
actgtcaatgcttgggcctcctaaatgccagtagtgccaccccctcctcttgtgacaacc  c.896-2521

.         .         .         .         .         .           g.1237648
gaaacacaccccacaaattttctagccacccctagggggcagtagcactcccactgagaa  c.896-2461

.         .         .         .         .         .           g.1237708
ccactgggccatatcaaagtaaaccagaaaacaagacagagttgccggattcttcatctg  c.896-2401

.         .         .         .         .         .           g.1237768
ttggtagatttaagccactacattattatgccatgggcgaggcaagctaagcaagcttca  c.896-2341

.         .         .         .         .         .           g.1237828
cgtttgaaatttcagctccagggcctcttcacccctcttgtttcagtgcagttggacaaa  c.896-2281

.         .         .         .         .         .           g.1237888
gtggtcttacaagatattctccattttgtttgttgacatcattgttttattccgcagaag  c.896-2221

.         .         .         .         .         .           g.1237948
tgtttaacactgcgagattaatcagcaagaagcccaggtgtcctgttggtgcctctctgg  c.896-2161

.         .         .         .         .         .           g.1238008
agcctcctgttagggaagcacggcatgagaggaaatgggcaccttgcgaggaaaatgacc  c.896-2101

.         .         .         .         .         .           g.1238068
aggccttgaatattggctctagcctgtatcagtcagatgaaggcgggtacatctgtgact  c.896-2041

.         .         .         .         .         .           g.1238128
tgagcatggagtgaggcaccctgcattggatctctctgggctcacaagagtcagtgagat  c.896-1981

.         .         .         .         .         .           g.1238188
gactcataatgtcatcaatgccgtaacgcccacccattgtccctttggaagttgctagga  c.896-1921

.         .         .         .         .         .           g.1238248
tactctgcatccattcctctttttttcctggtacactgcctcggtacattcctactgaca  c.896-1861

.         .         .         .         .         .           g.1238308
gccatggaaaggctagttttgagaggccaggcaaagctagcttctctgttctctgctctg  c.896-1801

.         .         .         .         .         .           g.1238368
cccagcctgagaacttgtctctcaggctcaactgcacatagaggtggccattgtgtcccc  c.896-1741

.         .         .         .         .         .           g.1238428
tgagaagggtggggacccctggaagcacatgggagtttcctgcaggcctgcagtattcta  c.896-1681

.         .         .         .         .         .           g.1238488
atacaatcaaatagaaggcaaggaggtctattaactgcaaagatcagaaattggtcttgg  c.896-1621

.         .         .         .         .         .           g.1238548
ccatctgggtgaggcagtgtgtggcacaaaggaaggaaccctggctttggggggacagac  c.896-1561

.         .         .         .         .         .           g.1238608
aacctcagtttgaccctgctcctacttcatacaacctgtatgaccctgagcaagttgctt  c.896-1501

.         .         .         .         .         .           g.1238668
ttccttgagcaccaatttcttcatccctaaaatacagataataatacctaccctgccggg  c.896-1441

.         .         .         .         .         .           g.1238728
atttcgtgaagacataaaacacctactagtgtacgtggcgtgttgtaggcatttaataag  c.896-1381

.         .         .         .         .         .           g.1238788
tggagcttgttgctgttactatgttactattattattataacaagtgttgcttgtgctcc  c.896-1321

.         .         .         .         .         .           g.1238848
tgttgaaatgtatatgtcttacctaaaaagaataatacagtgaacaattatcatggtaat  c.896-1261

.         .         .         .         .         .           g.1238908
acgtgtgagtacaggatgtggggttttgcagtgtgtaacctgtactgatgcatgaggtgc  c.896-1201

.         .         .         .         .         .           g.1238968
ccctgagtggacaataactttctttctttttttttttttagagacaagtgtctcactcta  c.896-1141

.         .         .         .         .         .           g.1239028
ttacccaggctgaagtgcagtagggtgatcatagctcagtgctgcttcaaactcttgggc  c.896-1081

.         .         .         .         .         .           g.1239088
tcaagtgatcctcccgcctcagcctcctgagtgccgagactatggaactctgagcatgtg  c.896-1021

.         .         .         .         .         .           g.1239148
ccaccattcctgactaattttttaaaatttttggtagagaagaggtcttgttatgttgct  c.896-961

.         .         .         .         .         .           g.1239208
aaagctggtctcaaactccaagcctcaagcaatcctcccacctggacctcccaaagtgct  c.896-901

.         .         .         .         .         .           g.1239268
aggattacaagcataagccaccacatctggccctattttttttttattctctaaaattgg  c.896-841

.         .         .         .         .         .           g.1239328
aataagaataataatacagaaatcatgcataatacctctcgctaccatttattacatggc  c.896-781

.         .         .         .         .         .           g.1239388
tcttgtatattaagcaacgtaataagtaactttctagcctctatctaatccaaaccatac  c.896-721

.         .         .         .         .         .           g.1239448
tactaactaacatttactgaatgttgatcctgtgtcaggtacaatactccacatattaaa  c.896-661

.         .         .         .         .         .           g.1239508
tatgtactatcaattaatcttcaaatcaacccagtgagatagaaggtgtttatacccatt  c.896-601

.         .         .         .         .         .           g.1239568
ttacaaataaagtcatggagccctagacagatttaagaactgctccccaaattacataga  c.896-541

.         .         .         .         .         .           g.1239628
taagaagtggccatttgaattttaacctaggtctctaaaactccaacattcagattctta  c.896-481

.         .         .         .         .         .           g.1239688
ctcactctgcacactgcctaagtcctgtgaaggaaggtattataacctggttttaccaca  c.896-421

.         .         .         .         .         .           g.1239748
aagagtcagactcttagagagcttatgcaattgagagggtcctaagtgcagcaggaagag  c.896-361

.         .         .         .         .         .           g.1239808
gaggcaaggagaaaacccaggaggcctgccttccatccttctgccctgtccctgagacac  c.896-301

.         .         .         .         .         .           g.1239868
acagcttctgaggctatgagactttagaaacttttagcaactacagaaatgtgattacta  c.896-241

.         .         .         .         .         .           g.1239928
gcattctagtttttgcttacagatcatctcctcagagaggatttccctgaccacttctct  c.896-181

.         .         .         .         .         .           g.1239988
aggatataggctctatgacagcaaggactttgtcttgttcatcttggcatccccagtccc  c.896-121

.         .         .         .         .         .           g.1240048
tggcacacagtctggcacttagttggtgcttgatacatttctgtcaattacctgagtcca  c.896-61

.         .         .         .         .         .           g.1240108
tgcatccttctttcccaggacaccagggaaacacctgactctcctttttcattctcccag  c.896-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center