disabled homolog 1 (Drosophila) (DAB1) - 3610 nt intron 14 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.1240717
gtgagtgcccctcacttaagacataaaacccaatgagagccgtaactcatgtctggaggc  c.1444+60

         .         .         .         .         .         .  g.1240777
ggggtttctggagtcaaataactcatctcacttgcattaatcaggcttctttgtttatat  c.1444+120

         .         .         .         .         .         .  g.1240837
tattattactagtaatactactatgagctgccaatttagataccactgataacatacaaa  c.1444+180

         .         .         .         .         .         .  g.1240897
ccttcttcatatgttccatgtttatttttagacttataataatgcttaatgataaatttt  c.1444+240

         .         .         .         .         .         .  g.1240957
gttagacctgtttgacagataatgaaagtgaggctcaaagatgaagacaatagacaaagt  c.1444+300

         .         .         .         .         .         .  g.1241017
ggtattgaattgaatgtaagcctggtatttttccaccatgttactctgcctcttaagatt  c.1444+360

         .         .         .         .         .         .  g.1241077
ttgtttgtttgctcattcattcgttcatttatttacgtatagatagcttatgacacacag  c.1444+420

         .         .         .         .         .         .  g.1241137
attttggcgtggcttattgaaataaaatgaatgcaaactttaaaaatttggggaacaagt  c.1444+480

         .         .         .         .         .         .  g.1241197
tttaaacattagaatataaaataaggatcaagagaaaacttagggcagagatacgcagcc  c.1444+540

         .         .         .         .         .         .  g.1241257
ataaggtcttaaatagcttttatagttgaagcctcattttgggttaaagcttctggtagt  c.1444+600

         .         .         .         .         .         .  g.1241317
taaagggaacaaaaagatagtgctgcagaaagttctggactgggaacctggagatcagat  c.1444+660

         .         .         .         .         .         .  g.1241377
ttattactgaccagttttgtgccttttggcaaagcactttatttctatgagccttggttt  c.1444+720

         .         .         .         .         .         .  g.1241437
cctcatctgtgtaagcgatgggttattaaaaggattcaatggtatatgtgctcaaacatt  c.1444+780

         .         .         .         .         .         .  g.1241497
atagaactcccagaatttgaagtatcttttatcctcattattagcacatgttaagtgttt  c.1444+840

         .         .         .         .         .         .  g.1241557
ttttgcagtcctggaccagagttctggtgttgactcctccaccacaagctgtgtctttgg  c.1444+900

         .         .         .         .         .         .  g.1241617
gcaagcgtatgacttctctgagactcagttttatcattggtaaaataagtgaattggctt  c.1444+960

         .         .         .         .         .         .  g.1241677
ggatgagcagtgtgcatccttctagttccagctttcagtgagtctcctccagctcatatt  c.1444+1020

         .         .         .         .         .         .  g.1241737
tcttctgcaaacatctggaaaacagtgactgtgcagccaaatcagaatccagatacactt  c.1444+1080

         .         .         .         .         .         .  g.1241797
gagcacatgtacacttgtttgacacaattcagggaaggtgttctgatgactcagcctgtg  c.1444+1140

         .         .         .         .         .         .  g.1241857
ccttgacacctgataagaggaaagaaaaggctcatgctgcagtgagtttggcggtttcat  c.1444+1200

         .         .         .         .         .         .  g.1241917
tactgtcacaggtgatatggatcactgcatggccaatactgtgaactgtcaaaaaaaaac  c.1444+1260

         .         .         .         .         .         .  g.1241977
acccctaatgttaatacaattagattgtgccatttcagccaggttcagaatgctattctg  c.1444+1320

         .         .         .         .         .         .  g.1242037
aaaatgaatgcccttaacgtgtataaacaacccacttgcactcaggccatatgatctaca  c.1444+1380

         .         .         .         .         .         .  g.1242097
tagtggcagcatctctatttatgcagactcacagggtttcaatgaggaataatgaataaa  c.1444+1440

         .         .         .         .         .         .  g.1242157
aaatgaaatgttaaagaaatgacagccatgcataaataagcaagcatctttttaaaaaca  c.1444+1500

         .         .         .         .         .         .  g.1242217
aacatctctctttcaatggacttgtgtgccagctacaaatgaaagaggagagtttaagtt  c.1444+1560

         .         .         .         .         .         .  g.1242277
ctttgagggcaggaactggctccatcattcctacacttctcataatgctagcttagtgcc  c.1444+1620

         .         .         .         .         .         .  g.1242337
tgggacatgagaggcatttgggaaaggttatagagaatgaaataaacaaaatggagatga  c.1444+1680

         .         .         .         .         .         .  g.1242397
cttagctactgttatgttttagagcatcgttggcaacctcggcactatggacatgttggg  c.1444+1740

         .         .         .         .         .         .  g.1242457
ccagataattctttgtttcagaggctgtcccattgtaggatgtttagcagcaacgctggc  c.1444+1800

       g.1242462
ctcta  c.1444+1805

--------------------- middle of intron ---------------------
                                          g.1242463           g.1242467
                                          c.1445-1805  atcac  c.1445-1801

.         .         .         .         .         .           g.1242527
tctatgagagaaacgtatatccccttcctctagtgtcgagaaaaatgactccaagcattg  c.1445-1741

.         .         .         .         .         .           g.1242587
ccaaatgtaccccagggatgaaattgccccagactgagaaccactgctttagagtattag  c.1445-1681

.         .         .         .         .         .           g.1242647
cagcatcctataaagccttctaaagattaagacacctgcataaataaactcctgcttatg  c.1445-1621

.         .         .         .         .         .           g.1242707
ctttccattgatttcattaggtaagtctgagcagtatacctgccagaactggcaactcag  c.1445-1561

.         .         .         .         .         .           g.1242767
cttgtgttctcaacctttagtaagcaaaaatccacttcaaatacaattcaggatctaatt  c.1445-1501

.         .         .         .         .         .           g.1242827
aagctaatatttattaaacatctactacccttcagggtgtttgcatatagctttaaaccc  c.1445-1441

.         .         .         .         .         .           g.1242887
actttcaatacagtttgttccatagtcatctcctgaaacaaaacagatttcattgcaaat  c.1445-1381

.         .         .         .         .         .           g.1242947
ttttttccaaaaacttgctgttttattttgaacaaaattagaaccagtctttatatcctc  c.1445-1321

.         .         .         .         .         .           g.1243007
tgacccatcagtatccccttaagaatgttttgggaagaggattggttggatcaaaagtga  c.1445-1261

.         .         .         .         .         .           g.1243067
acctcaaatagaaacagaaaagcacagttggactggatagtgtcagacagagctctgtta  c.1445-1201

.         .         .         .         .         .           g.1243127
aatgccagtgctgctatttcatagctgtgttaacccttcgcaagacacctcacctccctg  c.1445-1141

.         .         .         .         .         .           g.1243187
agctgcaatttctccatctgggaaacaaaaaagttatgataacaacttgcaggtatttat  c.1445-1081

.         .         .         .         .         .           g.1243247
attaaggtgtataatgaatgggaagtgcctagcacagtgtccaactcattggcacattat  c.1445-1021

.         .         .         .         .         .           g.1243307
aaataataagttaggaaatagcatcatctttctatatatagattcatcagagtaaaaagt  c.1445-961

.         .         .         .         .         .           g.1243367
atgcactaagttttacaatcattcactgtctgatttctaagttctataacattaggaaaa  c.1445-901

.         .         .         .         .         .           g.1243427
ttcagctgctaaatgaagtcatgccaccctctcacttgggtcttagccagtaaccagtat  c.1445-841

.         .         .         .         .         .           g.1243487
tttcagtgacaaattagaatttattaaaagaagagtggtatcaaatggcatatttgttct  c.1445-781

.         .         .         .         .         .           g.1243547
aaacctctaaaacaaatgagaggagatgtgggtgggtcagcccagaaaatgcgtatcctt  c.1445-721

.         .         .         .         .         .           g.1243607
tgtccttatagaatcaagtaccagctgtgaagttgccatcagctacatccattttcccag  c.1445-661

.         .         .         .         .         .           g.1243667
atcactgagacactttctctttattcaacatgtgtttattgaatacctcctatgtgccag  c.1445-601

.         .         .         .         .         .           g.1243727
gattcagaatctggttctaccagttgccatgagcaaattagcaaacttcactttccttac  c.1445-541

.         .         .         .         .         .           g.1243787
ctgtcaaattaggataacctctacctcaaagatgttttatgaggattagagatattgtct  c.1445-481

.         .         .         .         .         .           g.1243847
gtaaagtttctaacagtgtttgacacatgaaaggcgctcaataacgtgccctctgatgaa  c.1445-421

.         .         .         .         .         .           g.1243907
acacagaaagaagaaagcaaaccatagcccagtagttctcagcttgatcatgcatcagaa  c.1445-361

.         .         .         .         .         .           g.1243967
taacctgtagcaggttgttcaaacacagagtctgtgattcagtagatctggggtagggtc  c.1445-301

.         .         .         .         .         .           g.1244027
agaaaatttcatttctaacaaattcccagatgctactgctgctgcttgtccaaggaccat  c.1445-241

.         .         .         .         .         .           g.1244087
cctttgagaaccactgccttacctatcagtgtggacgagctccttcctgaagtcagatgt  c.1445-181

.         .         .         .         .         .           g.1244147
gtgagaggaaagatcaatacgtacagagagagaattcaaatattcaactgattccactgg  c.1445-121

.         .         .         .         .         .           g.1244207
aaataggaagaggaatcctaagatttgacttcaatataagcagattcctgaggtttcttt  c.1445-61

.         .         .         .         .         .           g.1244267
gggatacattcatggcagccaggcacttaagatgtctctttttctgtggtctctgtgtag  c.1445-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center