disabled homolog 1 (Drosophila) (DAB1) - 354 nt intron 15 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.1244455
gtaagtgaccagtttgttatttgtttgtgtttttccttaaaattaagacctctgtaactg  c.1572+60

         .         .         .         .         .         .  g.1244515
aaatggataatgcatgaggaagcctacatagaaaagaatgctggctcaatctcataagtt  c.1572+120

         .         .         .         .         .         g.1244572
ctcaaggggttgctaaaggggctttcttttgtgttcaaatgagtcagctgaaaagga  c.1572+177

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.1244629
   ctgcctttttattaaattgttactacaagtccacatttgtggtgtagcatcctctaa  c.1573-121

.         .         .         .         .         .           g.1244689
atgccgttgcaccctcctttacaataactgattgtgctgcatgaaagtatatccaggtgt  c.1573-61

.         .         .         .         .         .           g.1244749
cttatattttcaatgcttgaaaagagagaaaaaaaaaagtattatcttcttgtgttctag  c.1573-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center