disabled homolog 1 (Drosophila) (DAB1) - 12551 nt intron 16 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.1244920
gtaggtatctgtcctttttatctcctttacccttaagctatctgctttcccttttggttg  c.1683+60

         .         .         .         .         .         .  g.1244980
ttcttcacttctgaagccacatcctcaatgtttgcaccatgtctccttgcctgagctgta  c.1683+120

         .         .         .         .         .         .  g.1245040
ttgctgatgtttgcaccatcgctccttccctgaactgtattcctgatgtttgcactattt  c.1683+180

         .         .         .         .         .         .  g.1245100
cttcttgcctgagctatatcaccagtgtctgcaccatgtccctttgcctggtgtctacgt  c.1683+240

         .         .         .         .         .         .  g.1245160
tctactttgccttttctcatggatgcatgacctttgacatatcctgggaggtaggggtag  c.1683+300

         .         .         .         .         .         .  g.1245220
gggtgagaagtgggaactgatcatattattttattaataatatgttctgcgtggttggtg  c.1683+360

         .         .         .         .         .         .  g.1245280
gtgatagaatgaggcatggtccatgctacttagcatgcatttagtttctggaagcatcaa  c.1683+420

         .         .         .         .         .         .  g.1245340
cattttgagatggacacattctgcccaccctgataatttctcagtgagccatggtccaga  c.1683+480

         .         .         .         .         .         .  g.1245400
tgctttaatcttttaagcaaaatgtcactgcatttgcctacagtctgcagatctaaagag  c.1683+540

         .         .         .         .         .         .  g.1245460
gtcaccaatcaaacacacagagaagccagactaagaagcaaaaacaagcagtgcttgaaa  c.1683+600

         .         .         .         .         .         .  g.1245520
taagattgatcgagatgtaagatcagaggaagcccttttcgtctagccagaaaggaccct  c.1683+660

         .         .         .         .         .         .  g.1245580
gcaccctgcatcctttctgatgtgaaattcaaagcccagagatgtgtagcactcacttct  c.1683+720

         .         .         .         .         .         .  g.1245640
gaggctgtgctgtttgcacctgtgctgcagcatgtggattgccaccaaatcacttcagat  c.1683+780

         .         .         .         .         .         .  g.1245700
tccatcagcagctactttgagagagatgtacttacatttactagaagtggcttttggcac  c.1683+840

         .         .         .         .         .         .  g.1245760
ttgaatttcaatacatctgatttgatcgaaagaaagaggagctgatgaagcaaaccttct  c.1683+900

         .         .         .         .         .         .  g.1245820
taggagacagaagtacaccttgttacccagacatgatttctaaggtcacttcttgacaaa  c.1683+960

         .         .         .         .         .         .  g.1245880
cgtgttcaattttcagataccttcttagttttctataaacacacaggactgcaaggccat  c.1683+1020

         .         .         .         .         .         .  g.1245940
tcccaaaaggctccttttttaagttctgaacagcatggtcaaaaccattaaaatggtaaa  c.1683+1080

         .         .         .         .         .         .  g.1246000
cagttttctccactcataaatggattcggaggctacctcataaatggattctgaggctac  c.1683+1140

         .         .         .         .         .         .  g.1246060
ctcagaattagtcttagcccacacgtaagttagacagttactgaaagctaatatggtatt  c.1683+1200

         .         .         .         .         .         .  g.1246120
ttgaaagtgtattttgttaacaggtatttttattaaagaacctaacacactgtgtaggtt  c.1683+1260

         .         .         .         .         .         .  g.1246180
gccacattttgtatcagtgcaatagcacataataatatgtcatgccatgcaaaaccacct  c.1683+1320

         .         .         .         .         .         .  g.1246240
acgattcacttagaagttcactcttgcaaagctacttcgggagttgatatattgaaagca  c.1683+1380

         .         .         .         .         .         .  g.1246300
aagtcaatgtttcaggaaaaagaaaagttggggactataggcagactccttgggatgatt  c.1683+1440

         .         .         .         .         .         .  g.1246360
ccccacgaggtattttaccccccgcctaagttgtatttcacgtgctcaaccttgccttga  c.1683+1500

         .         .         .         .         .         .  g.1246420
aaaatttggtgaataaactagaggtgacaagagccattcatcaggataacagcaaacatc  c.1683+1560

         .         .         .         .         .         .  g.1246480
atcctaaaattgaagttcttctagaaaacaaagatgacttacaccatttgcagatcaatg  c.1683+1620

         .         .         .         .         .         .  g.1246540
tattaaaccctcatctttatgaacctgttcagcttgagacaatcctacaagccaaactgt  c.1683+1680

         .         .         .         .         .         .  g.1246600
ttcatggggctttggtctgttccacatttaatgctctgtccagtaccccaagccacagct  c.1683+1740

         .         .         .         .         .         .  g.1246660
gagctgtaaatggacatagcatagtagtgtgggaagaactcaggatttggacttgagttt  c.1683+1800

         .         .         .         .         .         .  g.1246720
aaatcctaactcagctacttaatagtgggaaatcttgggcaagaaccaaaatttgagtct  c.1683+1860

         .         .         .         .         .         .  g.1246780
tggtttcttcatctgctagaaggggcttatattctccataatggtaactgagatagttta  c.1683+1920

         .         .         .         .         .         .  g.1246840
tgttgagtatctagcgcagagacagacactgagtaatcagcttaaaattcagcttaaaaa  c.1683+1980

         .         .         .         .         .         .  g.1246900
aaatatctaggttctggaacaacattgtttgagttcagcatctggctccaccacttcctg  c.1683+2040

         .         .         .         .         .         .  g.1246960
gctatgtgacactgctgtgattttataattattctctatcttattttcttcatttgaaaa  c.1683+2100

         .         .         .         .         .         .  g.1247020
ataaggataaaaatagtgtccacctcatagggttattatgtgaactaaataaagtgatat  c.1683+2160

         .         .         .         .         .         .  g.1247080
atgtgaagctcttagcactgtgtatagcacatagaaagcacctaatagatgctagctacc  c.1683+2220

         .         .         .         .         .         .  g.1247140
ctcatcatcaccatcaccatcatcattatcatcatcattatcatcatcacatatatccaa  c.1683+2280

         .         .         .         .         .         .  g.1247200
ttaatgcacgctccccactctcttggattttatacatttagctttcatgtataagaccat  c.1683+2340

         .         .         .         .         .         .  g.1247260
tggttgggaggttttgctttgtactttgtcttcagataattaattttcaatatgtgtcac  c.1683+2400

         .         .         .         .         .         .  g.1247320
aacagctttggaagggaaaaaaagaaaaaagcctgctgcttagctctctggcttgcccca  c.1683+2460

         .         .         .         .         .         .  g.1247380
ccccataatcagaatggccctggtttgggcctcacacagctcactgccaaaaaatgggct  c.1683+2520

         .         .         .         .         .         .  g.1247440
gtcttagaatcacatgcaagtcaaaataagtacctcccagctccagaggagggctggact  c.1683+2580

         .         .         .         .         .         .  g.1247500
gtaatcttcggtgaagtaattttctccctttgaaagcttagcctggccacttcacagtta  c.1683+2640

         .         .         .         .         .         .  g.1247560
tcaagattcaagtgccaaggggcagatgccagctttgcagacatagccactatgacacac  c.1683+2700

         .         .         .         .         .         .  g.1247620
atgggggacgtctgggagagccattctgggtccctccatcgacagcagcacaagacacat  c.1683+2760

         .         .         .         .         .         .  g.1247680
ttaatctttccatctccatcccattcccccatccacccaactgaaaatttactgactgca  c.1683+2820

         .         .         .         .         .         .  g.1247740
atttcttagtgcctttccaaacatttggagaagagagaccatgcagggaaagttatgtcc  c.1683+2880

         .         .         .         .         .         .  g.1247800
atggctttattttttcccctctgctttcatatggttggaaagcaagagtcctgtctctct  c.1683+2940

         .         .         .         .         .         .  g.1247860
tatcacccttgcaaccattatcaccagctgttttttattagaaatacctgcacagttctg  c.1683+3000

         .         .         .         .         .         .  g.1247920
agtaagtagggatgacatctgttgataagctaaagccatatcacaccatagtaagaggaa  c.1683+3060

         .         .         .         .         .         .  g.1247980
acagacggactcaatccccacaggtggaagcttcagggccaatctcaaacagcagtgctg  c.1683+3120

         .         .         .         .         .         .  g.1248040
ttttagcaataaaggaaagtatcttcaattacttcacttttttccccctaccctcccatc  c.1683+3180

         .         .         .         .         .         .  g.1248100
tgggagaatcacgtgtctttgaaagactgggtcaacaagggcaaaaaagaaccaaaataa  c.1683+3240

         .         .         .         .         .         .  g.1248160
tattataatgactggtatgggaatggcaggtaatttatacttcactgatgtgttgctgga  c.1683+3300

         .         .         .         .         .         .  g.1248220
gcaattttgaggacgaaatgttagcttttgaggagatgaaagaaaaatgaaaacatttat  c.1683+3360

         .         .         .         .         .         .  g.1248280
ttggttaaatggctaagtaaataaactgcctatcagactttcccagctgtcaagtcagag  c.1683+3420

         .         .         .         .         .         .  g.1248340
tagcatctgtaacaatggggaattgtttggtctgcctcccttagtaacaatagatattgc  c.1683+3480

         .         .         .         .         .         .  g.1248400
cataaataataagttgctgtcattttttaatactgatcttcgtggtgggaatgcaagaca  c.1683+3540

         .         .         .         .         .         .  g.1248460
tataacatattacctgatggatttctagtgttcaagggaaaagaaagctgaaacctcaga  c.1683+3600

         .         .         .         .         .         .  g.1248520
tgctttgggaagacgaatcttaagagagtgagagaggaagagagagagagaaaaaaaagg  c.1683+3660

         .         .         .         .         .         .  g.1248580
aggtagggagggaagggaagaaaaggaaagaaaggaagaaacaaaacacagagtcagggg  c.1683+3720

         .         .         .         .         .         .  g.1248640
ccttaggtctgatttctacttccaaagcaggtcaccttaggtaagcatacatcctttcat  c.1683+3780

         .         .         .         .         .         .  g.1248700
atggataaatacagataattgcaatagctctctccccaagctgtccaagaatcaaataat  c.1683+3840

         .         .         .         .         .         .  g.1248760
atcataagtatgaaagtgttttataagctttgaaagtaaagtacatgtatttgggattat  c.1683+3900

         .         .         .         .         .         .  g.1248820
tattaccattctctttttaaatacaaccaaacaacagacccttaaaataaagaaccacaa  c.1683+3960

         .         .         .         .         .         .  g.1248880
aacaacagaaaatgacctattttatggacacagaactcaatgacaagtccaacctaagtt  c.1683+4020

         .         .         .         .         .         .  g.1248940
tttggagggcacagtgtcccacttccttggacctttatgaacagactccctgtcgaggtc  c.1683+4080

         .         .         .         .         .         .  g.1249000
ctgtagctagaaagtgatggcactggatcaggcagaagatgaccagggtctagctaaggg  c.1683+4140

         .         .         .         .         .         .  g.1249060
cagtgtcagccaagacctcaggcatagtgccaagagatgtttaaaagctgaaatcaacag  c.1683+4200

         .         .         .         .         .         .  g.1249120
aaggttaagaccgaagagacatgggaggtgaggaagaggacataaggtaggatgacaccc  c.1683+4260

         .         .         .         .         .         .  g.1249180
aggttcctggcatggggatctacatggtgccagtcactgtgctaaggaacacaagcagca  c.1683+4320

         .         .         .         .         .         .  g.1249240
tgtttgagcagaaagaagacaagtttactttgggaccaactgaactcaaggtgcccatga  c.1683+4380

         .         .         .         .         .         .  g.1249300
gacttccaagtagagatgccagtaggctgctggatacaacctctggagatcaaaagagaa  c.1683+4440

         .         .         .         .         .         .  g.1249360
atcaaggctagacatggagatttccatatgggtttcagccattggagtagtgagtgcaag  c.1683+4500

         .         .         .         .         .         .  g.1249420
tagaatacacagatcatctaaccagaagttgccaaactctctgtaaatatgtgtgccttg  c.1683+4560

         .         .         .         .         .         .  g.1249480
tgggccatactgtctctattacagctactctaccattgtcacaggaaagcagcaaaagat  c.1683+4620

         .         .         .         .         .         .  g.1249540
gatacataaatgaatgaatgtagctgtgttctaataagactttatttacaaacacaggca  c.1683+4680

         .         .         .         .         .         .  g.1249600
gctaccagaattggctaacagaattagatcaggctcactgtttctagaaccactgcagaa  c.1683+4740

         .         .         .         .         .         .  g.1249660
ggtaatcatgatacctttcacttactaataataataagatatattttaaaattactagca  c.1683+4800

         .         .         .         .         .         .  g.1249720
tcacctaatttaatcctcacaggaacactcaggtatttttattattcccatttcacaaat  c.1683+4860

         .         .         .         .         .         .  g.1249780
attgcagacaaggtagagagtttaacaacttgctaaaatcctgagattcacatgtaatag  c.1683+4920

         .         .         .         .         .         .  g.1249840
caccaggatttgaatctagacccagattaagtaattcaaacacactcaaacagaatcagg  c.1683+4980

         .         .         .         .         .         .  g.1249900
aaggacacctgggttttaatagcatcacatcaatttagctgtgtgatatgaggcagatgg  c.1683+5040

         .         .         .         .         .         .  g.1249960
tttcatttctgacctttggtttccttttctgtaaaacagttcccacaggtccttccagct  c.1683+5100

         .         .         .         .         .         .  g.1250020
ctgacattttaagaccatctaacttgcccaaagtcacccagctacagcatggaaccaatc  c.1683+5160

         .         .         .         .         .         .  g.1250080
cccaaataagatcttccagcagcatctctccctcaggctgtctctattcccatctaacaa  c.1683+5220

         .         .         .         .         .         .  g.1250140
aggagaagacagaaatccctaaaatacgctgacttcattaggatccccagagactatcag  c.1683+5280

         .         .         .         .         .         .  g.1250200
tcctagatgcaacctgctcccagtaaccaggagcttactcagaaaaggccttcctgctta  c.1683+5340

         .         .         .         .         .         .  g.1250260
tggtagataattagtgtcagcaatttcagcgtcatcatctgttatataacaaggccaaaa  c.1683+5400

         .         .         .         .         .         .  g.1250320
aagatgatgtacatgtgcaaaacagatcattgatgcccatcattgttgttattattgacg  c.1683+5460

         .         .         .         .         .         .  g.1250380
gggaaatagaatgttcttcagaacatgcacagttgcctcgaaactcaggtggtgcatctc  c.1683+5520

         .         .         .         .         .         .  g.1250440
tgtatgcaccaagcggatttcagcacccaagaccccaggaacaagggcattcggcagtgt  c.1683+5580

         .         .         .         .         .         .  g.1250500
caatccctaagggattatcatcaaatccattcagtgtttagaagacttttctaccctaac  c.1683+5640

         .         .         .         .         .         .  g.1250560
agccagactttcagactcaaagtggccagaaagctttgtttttccttttgtttgaatata  c.1683+5700

         .         .         .         .         .         .  g.1250620
aagaaaaagaaggctgccagcatttaagatacttcatgttatacgagctcacttgtaact  c.1683+5760

         .         .         .         .         .         .  g.1250680
tgtcacagtcccatgaggtagatgttattccctccactttacaaatgaaggaactggggt  c.1683+5820

         .         .         .         .         .         .  g.1250740
gcagataggtgagatgctcgcctaagttcatatcggaagttaggaggatttctggggtct  c.1683+5880

         .         .         .         .         .         .  g.1250800
ttctggctccccaaacccatgcatttttcctgaccctccacatggattcagatagaactt  c.1683+5940

         .         .         .         .         .         .  g.1250860
tgagttattttagcctttttcccctctgactaccaatacctttttcatttgtcaagccaa  c.1683+6000

         .         .         .         .         .         .  g.1250920
ggaatgtaaaactcccactgagctagtcctaagttttagggctaaaagaccatgaggctg  c.1683+6060

         .         .         .         .         .         .  g.1250980
aagttgctgcctgggcagggtaatgctgagggactcaagctttgactcaccttccagctt  c.1683+6120

         .         .         .         .         .         .  g.1251040
tagtctgatcctcagcttcgcttggcacttttcttaccctaggcccccgggatggggcat  c.1683+6180

         .         .         .         .         .         .  g.1251100
aagtaggctcactcagcaagctgattgcatggcgcaccatcgacctcacatctgagatca  c.1683+6240

         .         .         .        g.1251136
cctttgtcagcatgcagtgtcttcgctccactagta  c.1683+6276

--------------------- middle of intron ---------------------
            g.1251137         .         .         .           g.1251171
            c.1684-6275  agatgtattgcttttgacatacttttgtcaaaggt  c.1684-6241

.         .         .         .         .         .           g.1251231
agtcaatctttccaaaaacaaatacaagaaatattaaatgggcagaaagtaatcagcaca  c.1684-6181

.         .         .         .         .         .           g.1251291
atttaggtagcttccaagagcgtcttgttataatgtgacataggaaaccatttgccctta  c.1684-6121

.         .         .         .         .         .           g.1251351
tacttcatgccaaagagctggggctgggagaagaaagcaaggaaaccagcacagaaatgg  c.1684-6061

.         .         .         .         .         .           g.1251411
gagtctgaaccctgagctgctccctggctctccactgtctcctgtatagctttgggaaag  c.1684-6001

.         .         .         .         .         .           g.1251471
taccccttgtgtctggggcttcagtttcttcatgcggaaaaggagctgtaggtgtgaggg  c.1684-5941

.         .         .         .         .         .           g.1251531
cccttccagcttcaaccttctatgagagggaacacgtggtagtggagaggatagtaggct  c.1684-5881

.         .         .         .         .         .           g.1251591
taaaaagacctgagtatgtttacatgaaactctagaaaaaacaaacctagtctatagcaa  c.1684-5821

.         .         .         .         .         .           g.1251651
tcaaaagcagatcagagctggcactgagatagggagttgactgagaaggcacaagagaag  c.1684-5761

.         .         .         .         .         .           g.1251711
tctttagggtgaagaaatgctctatagctgacatgggtgtatatatttgtcaagttcatt  c.1684-5701

.         .         .         .         .         .           g.1251771
aaactgtacatttaaaatgggtacatttcattgtatgtaaattatacctcactgaaattg  c.1684-5641

.         .         .         .         .         .           g.1251831
atttaaaaacaagactaggtaaaatcgtggagatggaaagtagattagactagggctggg  c.1684-5581

.         .         .         .         .         .           g.1251891
gatttggggaatgaatggggagttaattgcttaatgggtacagagtttctgtttggggtg  c.1684-5521

.         .         .         .         .         .           g.1251951
atgaaagagttctggaaatgatgctgatggttgcacaacattgtgaatgtaattaatgct  c.1684-5461

.         .         .         .         .         .           g.1252011
gctgaattgtacacttaaacgtggttaaaatggcaaaggttatgttgtttatgtttcacc  c.1684-5401

.         .         .         .         .         .           g.1252071
acaaataaaaatctaaaaaagattaaaaaaaaaaagcagtatgtcccagctctgctgtgt  c.1684-5341

.         .         .         .         .         .           g.1252131
gctggctgagtaactgcacaggtcacccaactgcagggagcccaggtttctttgctgtaa  c.1684-5281

.         .         .         .         .         .           g.1252191
aatgaagacaggagctctaaaggcacagtcctggtgtgtagctcaagtaagactatgtga  c.1684-5221

.         .         .         .         .         .           g.1252251
cattggaaagaccgtatataaactgtaaaagtttctgtagagatataccattattactcc  c.1684-5161

.         .         .         .         .         .           g.1252311
agttctgtgagtccacttggctgctgtagtcgagcacataattcatagatagttaaagga  c.1684-5101

.         .         .         .         .         .           g.1252371
catgtggagtagtctgcaaacggtggaagtttctgttatccacagggccctgcagccagg  c.1684-5041

.         .         .         .         .         .           g.1252431
ttgtttgcattaactccacattcattctgcacaattttcctaggctggtccagcaccatt  c.1684-4981

.         .         .         .         .         .           g.1252491
cttttattaataactgagagctcatctgcaattgcacctatgtgctatgaaggagaggcc  c.1684-4921

.         .         .         .         .         .           g.1252551
atttgaaaagaaacccacaggtgattattaggcctaaaaccattgtctataaagggagga  c.1684-4861

.         .         .         .         .         .           g.1252611
taaagccacactcccagacataagggacctaatgttttttggagtatctcctatgtttca  c.1684-4801

.         .         .         .         .         .           g.1252671
gactctgtgctagacaatcaacatgttttctccttcacagagggtatttctagcctcatt  c.1684-4741

.         .         .         .         .         .           g.1252731
ttacagatgaggaaactggcacccaaagacgttaagtaccctgcacagaatcctagggct  c.1684-4681

.         .         .         .         .         .           g.1252791
gctaaatgtgtgatggtaagaaaaagaacagcagcctctgacagtcaggggcaggcccac  c.1684-4621

.         .         .         .         .         .           g.1252851
ccccacagcaaggtgctggcattctcctgttgaacatcaacatttcacataccatcagca  c.1684-4561

.         .         .         .         .         .           g.1252911
taaggcaaggccacttagtgaccatgataggtcaagacaaaatcaagaccaccaggtcat  c.1684-4501

.         .         .         .         .         .           g.1252971
catggctgaacacaggcaaaacatgaacattgtcaaaattggaaaactgatcaaacattt  c.1684-4441

.         .         .         .         .         .           g.1253031
ctctagcctggtttcagccttgctctgttcttcttgccttccagataagtattgttggga  c.1684-4381

.         .         .         .         .         .           g.1253091
taatcacagaattacccccacattatgacagcatccaattcagagaaaaaccccactttg  c.1684-4321

.         .         .         .         .         .           g.1253151
ttgaccatccccaaaattacttaccttaagcccaaatcttgtgatacattctttctaaca  c.1684-4261

.         .         .         .         .         .           g.1253211
ccctctttcagagatgcctcattgctcctccctctgcgctgaggaataacccaacatgtt  c.1684-4201

.         .         .         .         .         .           g.1253271
caactacagatgtgtccctggtggtctttgcagcagatcattggcaggagaacactaagc  c.1684-4141

.         .         .         .         .         .           g.1253331
taggcctgcatgacttagtctcctgtgctttagctcttttactgcaccttcgagaaaatt  c.1684-4081

.         .         .         .         .         .           g.1253391
gggtgtttcacttacagaaaggttagagggtggattttgctttaggttttaccatatggt  c.1684-4021

.         .         .         .         .         .           g.1253451
ttccatctactctgttatctaaaaataaagatattaatatgtcagaatcatattaaagtt  c.1684-3961

.         .         .         .         .         .           g.1253511
cacaactatttgccaacttccactaagaagagaactgttcatttactcacacatgtcttc  c.1684-3901

.         .         .         .         .         .           g.1253571
attcttcatgttgttagtggatgcacctcccatgttccaagcttcattcagaattcggga  c.1684-3841

.         .         .         .         .         .           g.1253631
tactgacatgcaaggcccagtggagctcagtgtagaacatgctaggagatgccatagtag  c.1684-3781

.         .         .         .         .         .           g.1253691
gagtgaagacagagatctgcacaggttctgaagcatccaggagcacagtggctcgtgtca  c.1684-3721

.         .         .         .         .         .           g.1253751
cctgcagagtccaggaagccttgatatttcagctaggtcttaaagtatgaactttaggaa  c.1684-3661

.         .         .         .         .         .           g.1253811
caaagaagcctccgaagccagaaggaactgcctgaatgaagtctcagagatgggaaaact  c.1684-3601

.         .         .         .         .         .           g.1253871
ccagcatgtgagggtgaaccccaagtagggtttggaaggtagggtgtaggagagagagtg  c.1684-3541

.         .         .         .         .         .           g.1253931
gcagtaggagaggctggttgggaaggtgggcattatgtgcagtcttgaggagtttgcctt  c.1684-3481

.         .         .         .         .         .           g.1253991
ttcctttgagtgacaaggagccaggagggctgtttcaggcaggagactggcatggccaaa  c.1684-3421

.         .         .         .         .         .           g.1254051
tccatttcagaaagatcatcctggaaagacataaagaaagatttttttaacatcatttac  c.1684-3361

.         .         .         .         .         .           g.1254111
gtgacctgaaggtagagttttgattcatgctctagaaggggtatttattagctctaatgg  c.1684-3301

.         .         .         .         .         .           g.1254171
actaagagactaatgggccttgtgtgcccggcgaaggtgctttgacctaccctgtgggtg  c.1684-3241

.         .         .         .         .         .           g.1254231
atggggagcctctgaaggatttgaagcagggcagagacgtggacaaatctgccaaaagaa  c.1684-3181

.         .         .         .         .         .           g.1254291
aacaaacaaacaaacaaaaacatcaacagcatgttatgttaatgtgcgattccatttagg  c.1684-3121

.         .         .         .         .         .           g.1254351
cttttggaattttgaaaatagctcaaagaccccgttatgaccttgacagaggccaggttg  c.1684-3061

.         .         .         .         .         .           g.1254411
gaaatttctgaatccaatgattctttagctcccctctaagtctgacagtctaagattcca  c.1684-3001

.         .         .         .         .         .           g.1254471
taataaggaaggtacagctattgccaaaacgtataatgcatcacagtgtcagactttggg  c.1684-2941

.         .         .         .         .         .           g.1254531
attatctgctgctgggggttttccacaccactgctccccttcattagtggggataattga  c.1684-2881

.         .         .         .         .         .           g.1254591
gagttgactgcagtcgttactgctgttgtgatgggtatttgaagctaaattcgggcaagt  c.1684-2821

.         .         .         .         .         .           g.1254651
aggagatgtgtgaatatttatctcagctgcagaaacttaatgcagtgtggcattaattac  c.1684-2761

.         .         .         .         .         .           g.1254711
cctgtctgagcctgctgtcttcttctgtttttaggtgtcattttcagttggataaattag  c.1684-2701

.         .         .         .         .         .           g.1254771
tttccaaaattagaatagagcaaattgtagggtgagatcaaggcagcctgacttcttggg  c.1684-2641

.         .         .         .         .         .           g.1254831
gcatccaaaaagaagaatgagctgagaacatctatccaggaaacattaatatgcgtgctt  c.1684-2581

.         .         .         .         .         .           g.1254891
gaagcccagcacaggcaaaaggaaatatttttccccagtagttgtacttaactatttttg  c.1684-2521

.         .         .         .         .         .           g.1254951
actccacctactgcacttgtagaacacaaacacacaataaagttacatgtttagccttac  c.1684-2461

.         .         .         .         .         .           g.1255011
aacatgtatttgaaatagttcaagagactggaaaggaatagatttggtgtttaataaatc  c.1684-2401

.         .         .         .         .         .           g.1255071
ataatcttactatagattttgctacatttgattttgagagaataaagccaaattggagtg  c.1684-2341

.         .         .         .         .         .           g.1255131
tatttaggacaaagggatcagaactgtgaggaaactagaaacagcattataatcattcag  c.1684-2281

.         .         .         .         .         .           g.1255191
taattcaacagactctcattgaggacctactgtgctaggttcatatttgtaaaatggcag  c.1684-2221

.         .         .         .         .         .           g.1255251
aaggaggcctggcgcggtggctcacacctgtaatctcagcactttgggaggccgaggtgg  c.1684-2161

.         .         .         .         .         .           g.1255311
gcggatcacaaggtcaggaaattgagaccatcctggctgacacagtgaaaccctgtctgt  c.1684-2101

.         .         .         .         .         .           g.1255371
actaaaaaatataaaaaattagccgggcgtggtggtgggcacctgtagtcccagctacac  c.1684-2041

.         .         .         .         .         .           g.1255431
gggaggctgaggcaggagaatggtgtgaacctgggaggccaagcttgcagtgagccgaca  c.1684-1981

.         .         .         .         .         .           g.1255491
tcgcgccactgcactctagcctgggcgacagagtgagactccatctcaaaaaaaaaaaaa  c.1684-1921

.         .         .         .         .         .           g.1255551
aaaaaaaaggcagaaggaactggcaagtggtaacctagaagtaggacatggaagaatggg  c.1684-1861

.         .         .         .         .         .           g.1255611
cttccgtacttttctgtcatcagacatttggacgaaggattgtacttatttacatttcca  c.1684-1801

.         .         .         .         .         .           g.1255671
agggcagtagaaagtctacgggcagaaggcatggagggacaagttggcactttgttacac  c.1684-1741

.         .         .         .         .         .           g.1255731
tgcataatagggtgcctccaaggaaagaagttccttcccactggaagaatacaaacataa  c.1684-1681

.         .         .         .         .         .           g.1255791
caagttctagaggaaccagaaattggatctgatggcaggagtcttggggtctactcttgg  c.1684-1621

.         .         .         .         .         .           g.1255851
catggatactaagtaaccctgtgactctgaagaaacaaaagctgtcttcacaggacttca  c.1684-1561

.         .         .         .         .         .           g.1255911
gattcctcatctgtacaatgatgggccagtacaaccttatcttctaggccattccacttt  c.1684-1501

.         .         .         .         .         .           g.1255971
acagtagaaagcaagcaatatgatatgctacacacaagagacagcacaatgaccttgaga  c.1684-1441

.         .         .         .         .         .           g.1256031
tcacacaacctttcagaacttcagtttttatctgcaaagggaggactcaaaaaataaaag  c.1684-1381

.         .         .         .         .         .           g.1256091
ccaccctcaggactataaggcagataaataagacatgaggtgctttgtaaactctgaagc  c.1684-1321

.         .         .         .         .         .           g.1256151
accaatggatggaaagattggggtctctctctctctgtctctccctcctcatggtcactg  c.1684-1261

.         .         .         .         .         .           g.1256211
ttgtaaaagattagaaaaagcactggcccctggaccctgttttcagttctcatgtctcta  c.1684-1201

.         .         .         .         .         .           g.1256271
gacttactagctgtgtgaccatgggcaaattatctaacttctctgtgcttaatttcaccc  c.1684-1141

.         .         .         .         .         .           g.1256331
ttgcaaaagagataaagcatctgccttacaaggctgttgtgatgagataaaaagacaatg  c.1684-1081

.         .         .         .         .         .           g.1256391
tacttgaaaatacctagcatggtgccagacacatggtaggggctcccagaatgccaattc  c.1684-1021

.         .         .         .         .         .           g.1256451
attttgaagtttcaagaaaaaagcaaataataagaacctatatgacaaggcaggggacaa  c.1684-961

.         .         .         .         .         .           g.1256511
gctaatatatcaaatatggtaaaattaggatttcattgtgcccgtttaattctggcacag  c.1684-901

.         .         .         .         .         .           g.1256571
acctccaagagtgacagcataaaggtcaattttaacagaaggtcctgtgcatgcttaaaa  c.1684-841

.         .         .         .         .         .           g.1256631
ccacagtatccatcaaatctgcttggccaaggcacaatgagccatctcaacatcagctga  c.1684-781

.         .         .         .         .         .           g.1256691
agtctgacggggtttaaatagggccgaacgctgtttcctatctaggtgtggattgcaggt  c.1684-721

.         .         .         .         .         .           g.1256751
ttgctgcattacatgctggttgaaaatccctgtatgtgtttcaggacagccccctgggtg  c.1684-661

.         .         .         .         .         .           g.1256811
caggcaaatgactggccaaagtggagggctcagactgaatggaaacaagtccagaagttt  c.1684-601

.         .         .         .         .         .           g.1256871
gtgattaagagacaaagacacacttgctgtttctctggctcaacagtgcacccaggcatc  c.1684-541

.         .         .         .         .         .           g.1256931
actatttgtagaagagcaatttgaaatagaatttcagggttctcaagtggacatttatga  c.1684-481

.         .         .         .         .         .           g.1256991
aactgtgttggaaaaatgtccacttgtctcatggtaattgttagcaatttctgaagatgt  c.1684-421

.         .         .         .         .         .           g.1257051
attgctagcaagcattgtgctagatactttatatgtgtaatctctaattccctcaagaac  c.1684-361

.         .         .         .         .         .           g.1257111
cccgtaggataaacagtactattcccattttgtggttggagaaaccaagactcaggataa  c.1684-301

.         .         .         .         .         .           g.1257171
gtatcttgtccacatgacacagcttttctaactctccctactataccatgctacttccct  c.1684-241

.         .         .         .         .         .           g.1257231
aacagggcaatcagttccaacttgaaaacgaaagacagaactgagtgcatagctattttg  c.1684-181

.         .         .         .         .         .           g.1257291
gataataaaaatgttgccaaaatgttatgcaccctgatcaaatactccaaaaataaccta  c.1684-121

.         .         .         .         .         .           g.1257351
aggtcatccatcataaactgtcacttttctgttttaatcctaaaccccttttcccaaagc  c.1684-61

.         .         .         .         .         .           g.1257411
tgtctcagaaaatccatgcaagtgtaaagagcaggcctcactttgttcctttatccacag  c.1684-1


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center