disabled homolog 1 (Drosophila) (DAB1) - upstream reference sequence


                  g.1         .         .         .             g.34
                  c.-5674 gagataatagaagcctagagctgttggtggccat    c.-5641

.         .         .         .         .         .             g.94
gacccctcctgcttcctacaggaagaaagctttctgaaatgggggtatagaaggagagag    c.-5581

.         .         .         .         .         .             g.154
agagagagagagagagagaatgaacaagcaagcaagagagttcacagacgtgatgacatc    c.-5521

.         .         .         .         .         .             g.214
atcaatagaaaagaactggcttcactctggactgccaagtgacaaacgcctctgtctttg    c.-5461

.         .         .         .         .         .             g.274
ccttaataaattccctttgccgggctaatatccagaatctacaatgaactcaaacaaatt    c.-5401

.         .         .         .         .         .             g.334
tacaagaaaaaaacaaacaaccccatcaaaaagtgggcgaaggacatgaacagacacttc    c.-5341

.         .         .         .         .         .             g.394
tcaaaagaagacatttatgcagccaaaaaatacatgaaaaaatgctcatcatcactggcc    c.-5281

.         .         .         .         .         .             g.454
atcagagaaatgcaaatcaaaaccactatgagatatcatctcacaccagttagaatggca    c.-5221

.         .         .         .         .         .             g.514
atcattaaaaagtcaggaaacaacaggtgctggagaggatgtggagaaataggaacactt    c.-5161

.         .         .         .         .         .             g.574
ttacactgttggtgggactgtaaactagttcaaccattgtggaagtcagtgtggcgattc    c.-5101

.         .         .         .         .         .             g.634
ctcagggatctagaactagaaataccatttgacccagccatcccattactgggtatatac    c.-5041

.         .         .         .         .         .             g.694
ccaaatgactataaatcatgctgctataaagacacatgcggctataaagacgtatgttta    c.-4981

.         .         .         .         .         .             g.754
ttgcggcattattcacaatagcaaagacttggaaccaacccaaatgtccaacaatgatag    c.-4921

.         .         .         .         .         .             g.814
actggattaagaaaatgtggcatatatacaccatggaatactatgcagccataaaaaatg    c.-4861

.         .         .         .         .         .             g.874
atgagttcatgtcctttgtagggacatggatgaaattggaaaccatcattctcagtaaac    c.-4801

.         .         .         .         .         .             g.934
tatgcaagaacaaaaaaccaaacaccgcatattctcacttataggtgggaattgaacaat    c.-4741

.         .         .         .         .         .             g.994
gagatcacatggacacaggaaggggaatatcacactctggggactgtggtggggtggggg    c.-4681

.         .         .         .         .         .             g.1054
gaggggggagggatagcattgggagatatacctaatgctagatgacgagttagtgggtgc    c.-4621

.         .         .         .         .         .             g.1114
agcgcaccagcatggcacatgtatacatatgtaactaacctgcacaatgtgcacatgtac    c.-4561

.         .         .         .         .         .             g.1174
cctaaaacttaaagtataataaaaaaaaaatagaaaaaaaaataaataaattccctttgc    c.-4501

.         .         .         .         .         .             g.1234
cttaagctgttgatctcgacctctctcaaaggaggtgggtggggtagggggcagcactgg    c.-4441

.         .         .         .         .         .             g.1294
agtaggaaatgactgtatttctacaaacagcaagagagaaaagcaacaaggtttctgaac    c.-4381

.         .         .         .         .         .             g.1354
aactctggctatgcctgtaattaaaattacatcattttatccttcacattcccattgtct    c.-4321

.         .         .         .         .         .             g.1414
ttatactaatatacgtttaaaaaggatctgagtcaatatcttattgcatgtttccccttg    c.-4261

.         .         .         .         .         .             g.1474
agtgtggatctgaagtgaatgtggtgaatgtgtgcagggtggtcctgcctcctctgtggt    c.-4201

.         .         .         .         .         .             g.1534
ttataagttactctagggcttgggatttgttgtttccatattttttctccagccactaac    c.-4141

.         .         .         .         .         .             g.1594
tataatattcatacttttatccttgtagggtgctttacaaattattttcatctgcattat    c.-4081

.         .         .         .         .         .             g.1654
ctcatttgattctcagggtatctgcgaagggctgggatgactattcctgcctgtccagtt    c.-4021

.         .         .         .         .         .             g.1714
gaaaaacagaagctcaggtcctagtatcatggccctgaaagagaaagacatttgcagagc    c.-3961

.         .         .         .         .         .             g.1774
ttgtgcagtgatcacccaggtaatgtatggtacagagcgtagaaggatccctagatttgg    c.-3901

.         .         .         .         .         .             g.1834
agccagaaggctcaggattgaatcttaactcttactagttagctgttggtctttgagcaa    c.-3841

.         .         .         .         .         .             g.1894
gtcactcaatctctctggttctcagttttaccatctgtcagttggggaaatagggatgat    c.-3781

.         .         .         .         .         .             g.1954
catttcccttcaaggattcttgtgaatatcacaggaaataacgtaaaataaagtgctctc    c.-3721

.         .         .         .         .         .             g.2014
taaactgtcaagggcagcccaactatttgaggctgatttttatcagtggtgatgtgatgg    c.-3661

.         .         .         .         .         .             g.2074
gtccagctggtagtacagactcacaataactgaccgtgcacacctcttcttaattccaca    c.-3601

.         .         .         .         .         .             g.2134
ttcagtgacacacttttttggtaacttgaaatcagccaaggggaggatatttacactcag    c.-3541

.         .         .         .         .         .             g.2194
gaaattggcaaatgccatgactcagggctttattgttaatcaggcttgttaacaacaatc    c.-3481

.         .         .         .         .         .             g.2254
agagtcagttgttaaccagttgccagtggtggtggggttggcaggagagaagaaaatgat    c.-3421

.         .         .         .         .         .             g.2314
accaatatttaagaacatagatagataaatgagcaaatccttagagcatttcctttagtc    c.-3361

.         .         .         .         .         .             g.2374
ttcacagctcctggggcagatagtgattcaattttttagataaggtaattaaaactttga    c.-3301

.         .         .         .         .         .             g.2434
gaggttcataacttgcttagaaaacacaataaatgacaggagaggttcgaagtcagatct    c.-3241

.         .         .         .         .         .             g.2494
cacattctctctgattcccatgcagcaacccaaaggtacatccactagcatctgttctct    c.-3181

.         .         .         .         .         .             g.2554
ccctgatttccaacccagcagtagtgagtaagtttctatgaccacttaacatttaagatc    c.-3121

.         .         .         .         .         .             g.2614
cctatctggacttcaatatactagttttggagttggagaaactagctcggaaaagatgga    c.-3061

.         .         .         .         .         .             g.2674
gagaagtgcaatacattgagttgggcacaagggaatgagttgactgtcttggcgatctac    c.-3001

.         .         .         .         .         .             g.2734
agttctgggtctcaattggataagtgcttcggggccctgggaattaggcaacaccattag    c.-2941

.         .         .         .         .         .             g.2794
ggttggggtcatttgaagcacctgggcttagagaaggagaaagtcaagagcacctgggtc    c.-2881

.         .         .         .         .         .             g.2854
caagttccagctctgctacttcacctgtctggggtttagctttctcatctgtcaaagggg    c.-2821

.         .         .         .         .         .             g.2914
ggcaatatcaaatcatgcctgttttatctcattgagtttctgtggtagcagtggggagca    c.-2761

.         .         .         .         .         .             g.2974
agatcctggaggcctctggaatctgttacactatactgatatcagaaattatcacgtgtc    c.-2701

.         .         .         .         .         .             g.3034
tcagccgaaaacctttcctcctgttgctaagagagaaaggactgtctgtttccctttctt    c.-2641

.         .         .         .         .         .             g.3094
gccatctctggctctacacatccccaaacagctctgttttcctttctatttttatatctt    c.-2581

.         .         .         .         .         .             g.3154
gagtgctttatatgatgatgtcctgcatgcttctaactagatgaaggtggcagacaggaa    c.-2521

.         .         .         .         .         .             g.3214
aaaattgaaaagacctaaacaaaatgaaaatctttcctgctcgaaatgtttcctgcttga    c.-2461

.         .         .         .         .         .             g.3274
gaaaaagacagatgggttcaggggctggcattactaatgcaagcatcccagatgctgaga    c.-2401

.         .         .         .         .         .             g.3334
gaagcttttcatggactcaacaaacaggcaacccctgcctggtcctggacaggacagaag    c.-2341

.         .         .         .         .         .             g.3394
ggttataggagcactccagaggctccttgaagacctgaaagtagagaaatgttgaacatg    c.-2281

.         .         .         .         .         .             g.3454
aaattaatggtcatttagcaccttaggtgccttccttgtcacatttcatcctcacaatac    c.-2221

.         .         .         .         .         .             g.3514
ttgtatgagaatatatagattattatttatattttccagttaaggaaaaggatactcaga    c.-2161

.         .         .         .         .         .             g.3574
gagtggtaggagaaactcatacccagacccccagggtagctgtccagtggcctttttttc    c.-2101

.         .         .         .         .         .             g.3634
ctagcggaactacaggcagaggggaagttgctgtggttgtggaggtcagggaacttgaaa    c.-2041

.         .         .         .         .         .             g.3694
gggacttttattcagcactgtgggacactctgattggatcctctccttccacccacgccc    c.-1981

.         .         .         .         .         .             g.3754
ccttcagtacattctctgcacagcagctggagtgagcttttacaaataaaaatcacactc    c.-1921

.         .         .         .         .         .             g.3814
tttccaatcctgtaacagttacatctctaacccccaaaactccaaacttagcatcaagtc    c.-1861

.         .         .         .         .         .             g.3874
aatttcccttactgatctttacccataagaccagcctccctcttcaacctctccacctca    c.-1801

.         .         .         .         .         .             g.3934
tctcgtgtcaccaactcatcactcttgctacattctagccacacttccttccttctgcta    c.-1741

.         .         .         .         .         .             g.3994
ttcaaacacattcaacctgttccttcttcagggccttggctcttgttccctctatttcta    c.-1681

.         .         .         .         .         .             g.4054
atgactggttccttatcatacagatctcagattagtggtcatgtgcttggaggcctcttt    c.-1621

.         .         .         .         .         .             g.4114
cccaaatgcccagcctgatgtcctaccctagtcattttctatcacatgtcgccatctact    c.-1561

.         .         .         .         .         .             g.4174
taaattttggtcaatagcgattattactatccaatagtttcttgctgatttacttgttta    c.-1501

.         .         .         .         .         .             g.4234
ttttccgtcttactaaagagcaggttacaagagaataaacattacttgtctgtgttcttt    c.-1441

.         .         .         .         .         .             g.4294
tgaatgttctgctcctctccataaagtagaggtaggctcatagtaagcacacaaaaatat    c.-1381

.         .         .         .         .         .             g.4354
ttattgatgagtgaattgttactgatatataattacctcaggaagggcagacctgcatca    c.-1321

.         .         .         .         .         .             g.4414
gatgaaggaagaaaaactcatgttttgctatcacttaccatgtgtcaagctctgtgcttg    c.-1261

.         .         .         .         .         .             g.4474
tctcatgtgattctcacaattatatgagacatatggttcccattttgtagatgaagaaat    c.-1201

.         .         .         .         .         .             g.4534
ggaagctcaatcatttggtcgtttgataagaccacacagctacaactgaaaccctggtct    c.-1141

.         .         .         .         .         .             g.4594
gcctgcttcagtgccgacacacttgattgtggggtgtgcataacatgtctcaggggttta    c.-1081

.         .         .         .         .         .             g.4654
tgtacctgcagaagagtgtgtgtctgctgctgcaaaatcttgcacctgtgaacaccccaa    c.-1021

.         .         .         .         .         .             g.4714
gaaggaggaggctgtgtaaaagcacgtgcaggccaagaccctagaggcagcacagagagg    c.-961

.         .         .         .         .         .             g.4774
gctctccccagtaaatcacttttgcttaacctgaagtccatacttcccaggggagcagac    c.-901

.         .         .         .         .         .             g.4834
actgagaactgcaaactgaagactgcagaatggctgcaagttgtagacctcactgtgacc    c.-841

.         .         .         .         .         .             g.4894
gtagcggagaagggagtctgcgagtgggtgctgaggtccttccccctcagagctcacatt    c.-781

.         .         .         .         .         .             g.4954
caggccaggtcggtcaggccgcgccacctcttcctgcagcagcattccgcgctaggtggc    c.-721

.         .         .         .         .            .          g.5014
gaaatgctgaggggctcccctattcgggggaatgcggtagtgatgt \ ataaggtatgaaag c.-661


Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center