dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis) (DACT1) - coding DNA reference sequence

(used for variant description)

(last modified June 29, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_016651.5 in the DACT1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032025.1, covering DACT1 transcript NM_016651.5.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.9015
                 ggcggtcgcgcgcaggactcgagggcttctagccaccgtccccg       c.-121

 .         .         .         .         .         .                g.9075
 ccagcgccgcgccccgccacagggcggcatgagcccacccgcggccgcagccctagcgcc       c.-61

 .         .         .         .         .         .                g.9135
 ctgctcctccgcctgggcggcccggctgcggtgacggctctcgctgcccgactgggggcc       c.-1

          .         .         .         .         .         .       g.9195
 ATGAAGCCGAGTCCGGCCGGGACGGCGAAGGAGCTGGAGCCTCCGGCGCCGGCCCGAGGC       c.60
 M  K  P  S  P  A  G  T  A  K  E  L  E  P  P  A  P  A  R  G         p.20

          .         .         .         .         .         .       g.9255
 GAGCAGCGCACGGCGGAGCCCGAGGGGCGCTGGCGGGAGAAGGGCGAGGCAGACACCGAG       c.120
 E  Q  R  T  A  E  P  E  G  R  W  R  E  K  G  E  A  D  T  E         p.40

          .         .         .         .         .         .       g.9315
 CGGCAGCGCACCCGGGAGCGGCAGGAGGCCACGCTGGCCGGGCTGGCGGAGCTGGAGTAC       c.180
 R  Q  R  T  R  E  R  Q  E  A  T  L  A  G  L  A  E  L  E  Y         p.60

          .         .         .         .         .         .       g.9375
 CTGCGCCAGCGCCAAGAGCTGCTGGTCAGGGGCGCCCTGCGCGGCGCCGGGGGTGCGGGA       c.240
 L  R  Q  R  Q  E  L  L  V  R  G  A  L  R  G  A  G  G  A  G         p.80

          .         .         .         .         .         .       g.9435
 GCCGCTGCGCCCCGCGCTGGGGAGCTACTGGGGGAGGCGGCGCAGCGCAGTCGCCTGGAG       c.300
 A  A  A  P  R  A  G  E  L  L  G  E  A  A  Q  R  S  R  L  E         p.100

          .         .         .         .      | 02  .         .    g.11683
 GAGAAGTTCTTGGAGGAGAACATCTTGCTGCTAAGAAAGCAATTG | AACTGTTTGAGGCGA    c.360
 E  K  F  L  E  E  N  I  L  L  L  R  K  Q  L   | N  C  L  R  R      p.120

          .         .         .         .         .         .       g.11743
 AGAGATGCTGGTTTGTTGAATCAGTTGCAAGAGCTTGACAAGCAGATAAGTGACCTGAGA       c.420
 R  D  A  G  L  L  N  Q  L  Q  E  L  D  K  Q  I  S  D  L  R         p.140

          .         .         .         .         .         | 03    g.12526
 CTGGATGTAGAAAAGACATCTGAAGAGCACCTGGAGACAGACAGTCGGCCTAGCTCAG | GG    c.480
 L  D  V  E  K  T  S  E  E  H  L  E  T  D  S  R  P  S  S  G |       p.160

          .         .         .         .         .         .       g.12586
 TTTTATGAGCTGAGTGATGGGGCTTCAGGATCCCTTTCCAATTCCTCTAACTCGGTGTTC       c.540
 F  Y  E  L  S  D  G  A  S  G  S  L  S  N  S  S  N  S  V  F         p.180

          .         .         .         .         .         .       g.12646
 AGTGAGTGTTTATCCAGTTGTCATTCCAGCACCTGCTTTTGCAGCCCCTTGGAGGCGACC       c.600
 S  E  C  L  S  S  C  H  S  S  T  C  F  C  S  P  L  E  A  T         p.200

          .         .         .     | 04   .         .         .    g.16216
 TTGAGTCTCTCAGATGGTTGCCCCAAATCTGCAG | ATCTCATAGGATTGTTGGAATATAAA    c.660
 L  S  L  S  D  G  C  P  K  S  A  D |   L  I  G  L  L  E  Y  K      p.220

          .         .         .         .         .         .       g.16276
 GAAGGCCACTGTGAAGACCAGGCCTCAGGGGCAGTTTGCCGTTCCCTCTCCACACCACAA       c.720
 E  G  H  C  E  D  Q  A  S  G  A  V  C  R  S  L  S  T  P  Q         p.240

          .         .         .         .         .         .       g.16336
 TTTAATTCCCTTGATGTCATTGCAGATGTGAATCCCAAGTACCAGTGTGATCTGGTGTCT       c.780
 F  N  S  L  D  V  I  A  D  V  N  P  K  Y  Q  C  D  L  V  S         p.260

          .         .         .         .         .         .       g.16396
 AAAAACGGGAATGATGTATATCGCTATCCCAGTCCACTTCATGCTGTGGCTGTGCAGAGC       c.840
 K  N  G  N  D  V  Y  R  Y  P  S  P  L  H  A  V  A  V  Q  S         p.280

          .         .         .         .         .         .       g.16456
 CCAATGTTTCTCCTTTGTCTGACGGGCAACCCTCTGAGGGAAGAGGACAGGCTTGGAAAC       c.900
 P  M  F  L  L  C  L  T  G  N  P  L  R  E  E  D  R  L  G  N         p.300

          .         .         .         .         .         .       g.16516
 CATGCCAGTGACATTTGCGGTGGATCTGAGCTAGATGCCGTCAAAACAGACAGTTCCTTA       c.960
 H  A  S  D  I  C  G  G  S  E  L  D  A  V  K  T  D  S  S  L         p.320

          .         .         .         .         .         .       g.16576
 CCGTCCCCAAGCAGTCTGTGGTCTGCTTCCCATCCTTCATCCAGCAAGAAAATGGATGGC       c.1020
 P  S  P  S  S  L  W  S  A  S  H  P  S  S  S  K  K  M  D  G         p.340

          .         .         .         .         .         .       g.16636
 TACATTCTGAGCCTGGTCCAGAAAAAAACACACCCTGTAAGGACCAACAAACCAAGAACC       c.1080
 Y  I  L  S  L  V  Q  K  K  T  H  P  V  R  T  N  K  P  R  T         p.360

          .         .         .         .         .         .       g.16696
 AGCGTGAACGCTGACCCCACGAAAGGGCTTCTGAGGAACGGGAGCGTTTGTGTCAGAGCC       c.1140
 S  V  N  A  D  P  T  K  G  L  L  R  N  G  S  V  C  V  R  A         p.380

          .         .         .         .         .         .       g.16756
 CCGGGCGGTGTCTCACAGGGCAACAGTGTGAACCTTAAGAATTCGAAACAGGCGTGTCTG       c.1200
 P  G  G  V  S  Q  G  N  S  V  N  L  K  N  S  K  Q  A  C  L         p.400

          .         .         .         .         .         .       g.16816
 CCCTCTGGCGGGATACCTTCTCTGAACAATGGGACATTCTCCCCACCGAAGCAGTGGTCG       c.1260
 P  S  G  G  I  P  S  L  N  N  G  T  F  S  P  P  K  Q  W  S         p.420

          .         .         .         .         .         .       g.16876
 AAAGAATCAAAGGCCGAACAAGCCGAAAGCAAGAGGGTGCCCCTGCCAGAGGGCTGCCCC       c.1320
 K  E  S  K  A  E  Q  A  E  S  K  R  V  P  L  P  E  G  C  P         p.440

          .         .         .         .         .         .       g.16936
 TCAGGCGCTGCCTCCGACCTTCAGAGTAAGCACCTGCCAAAAACGGCCAAGCCAGCCTCG       c.1380
 S  G  A  A  S  D  L  Q  S  K  H  L  P  K  T  A  K  P  A  S         p.460

          .         .         .         .         .         .       g.16996
 CAAGAACATGCTCGGTGTTCCGCCATTGGGACAGGGGAGTCCCCTAAGGAAAGCGCTCAG       c.1440
 Q  E  H  A  R  C  S  A  I  G  T  G  E  S  P  K  E  S  A  Q         p.480

          .         .         .         .         .         .       g.17056
 CTCTCAGGGGCCTCTCCAAAAGAGAGTCCTAGCAGAGGCCCTGCCCCGCCGCAGGAGAAC       c.1500
 L  S  G  A  S  P  K  E  S  P  S  R  G  P  A  P  P  Q  E  N         p.500

          .         .         .         .         .         .       g.17116
 AAAGTTGTACAGCCCCTGAAAAAGATGTCACAGAAAAACAGCCTGCAGGGCGTCCCCCCG       c.1560
 K  V  V  Q  P  L  K  K  M  S  Q  K  N  S  L  Q  G  V  P  P         p.520

          .         .         .         .         .         .       g.17176
 GCCACTCCTCCCCTGCTGTCTACAGCTTTCCCCGTGGAAGAGAGGCCTGCCTTGGATTTC       c.1620
 A  T  P  P  L  L  S  T  A  F  P  V  E  E  R  P  A  L  D  F         p.540

          .         .         .         .         .         .       g.17236
 AAGAGCGAGGGCTCTTCCCAAAGCCTGGAGGAAGCGCACCTGGTCAAGGCCCAGTTTATC       c.1680
 K  S  E  G  S  S  Q  S  L  E  E  A  H  L  V  K  A  Q  F  I         p.560

          .         .         .         .         .         .       g.17296
 CCGGGGCAGCAGCCCAGTGTCAGGCTCCACCGGGGCCACAGGAACATGGGCGTCGTGAAG       c.1740
 P  G  Q  Q  P  S  V  R  L  H  R  G  H  R  N  M  G  V  V  K         p.580

          .         .         .         .         .         .       g.17356
 AACTCCAGCCTGAAGCACCGCGGCCCAGCCCTCCAGGGGCTGGAGAACGGCTTGCCCACC       c.1800
 N  S  S  L  K  H  R  G  P  A  L  Q  G  L  E  N  G  L  P  T         p.600

          .         .         .         .         .         .       g.17416
 GTCAGGGAGAAAACGCGGGCCGGGAGCAAGAAGTGTCGCTTCCCAGATGACTTGGATACA       c.1860
 V  R  E  K  T  R  A  G  S  K  K  C  R  F  P  D  D  L  D  T         p.620

          .         .         .         .         .         .       g.17476
 AATAAGAAACTCAAGAAAGCCTCCTCCAAGGGGAGGAAGAGTGGGGGCGGGCCCGAGGCT       c.1920
 N  K  K  L  K  K  A  S  S  K  G  R  K  S  G  G  G  P  E  A         p.640

          .         .         .         .         .         .       g.17536
 GGTGTTCCCGGCAGGCCCGCGGGCGGGGGCCACAGGGCGGGGAGCAGGGCGCATGGCCAC       c.1980
 G  V  P  G  R  P  A  G  G  G  H  R  A  G  S  R  A  H  G  H         p.660

          .         .         .         .         .         .       g.17596
 GGACGGGAGGCGGTGGTGGCCAAACCTAAGCACAAGCGAACTGACTACCGGCGGTGGAAG       c.2040
 G  R  E  A  V  V  A  K  P  K  H  K  R  T  D  Y  R  R  W  K         p.680

          .         .         .         .         .         .       g.17656
 TCCTCGGCCGAGATTTCCTACGAAGAGGCCCTGAGGAGGGCCCGGCGCGGTCGCCGGGAG       c.2100
 S  S  A  E  I  S  Y  E  E  A  L  R  R  A  R  R  G  R  R  E         p.700

          .         .         .         .         .         .       g.17716
 AATGTGGGGCTGTACCCCGCGCCTGTGCCTCTGCCCTACGCCAGCCCCTACGCCTACGTG       c.2160
 N  V  G  L  Y  P  A  P  V  P  L  P  Y  A  S  P  Y  A  Y  V         p.720

          .         .         .         .         .         .       g.17776
 GCTAGCGACTCCGAGTACTCGGCCGAGTGCGAGTCCCTGTTCCACTCCACCGTGGTGGAC       c.2220
 A  S  D  S  E  Y  S  A  E  C  E  S  L  F  H  S  T  V  V  D         p.740

          .         .         .         .         .         .       g.17836
 ACCAGTGAGGACGAGCAGAGCAATTACACCACCAACTGCTTCGGGGACAGCGAGTCGAGT       c.2280
 T  S  E  D  E  Q  S  N  Y  T  T  N  C  F  G  D  S  E  S  S         p.760

          .         .         .         .         .         .       g.17896
 GTGAGCGAGGGCGAGTTCGTGGGGGAGAGCACAACCACCAGCGACTCTGAAGAAAGCGGG       c.2340
 V  S  E  G  E  F  V  G  E  S  T  T  T  S  D  S  E  E  S  G         p.780

          .         .         .         .         .         .       g.17956
 GGCTTAATTTGGTCCCAGTTTGTCCAGACTCTGCCCATTCAAACGGTAACGGCCCCAGAC       c.2400
 G  L  I  W  S  Q  F  V  Q  T  L  P  I  Q  T  V  T  A  P  D         p.800

          .         .         .         .         .         .       g.18016
 CTTCACAACCACCCCGCAAAAACCTTTGTCAAAATTAAGGCCTCACATAACCTCAAGAAG       c.2460
 L  H  N  H  P  A  K  T  F  V  K  I  K  A  S  H  N  L  K  K         p.820

          .         .         .         .         .                 g.18067
 AAGATCCTCCGCTTTCGGTCTGGCTCTTTGAAACTGATGACGACGGTTTGA                c.2511
 K  I  L  R  F  R  S  G  S  L  K  L  M  T  T  V  X                  p.836

          .         .         .         .         .         .       g.18127
 gtgacatcattggtgtagaaagtttgtgtgtttttttttcttctccctagttgccaaaat       c.*60

          .         .         .         .         .         .       g.18187
 taaaaaggtggtgttttcatttttgtataatactttaatggaatgctttttaaaaaaata       c.*120

          .         .         .         .         .         .       g.18247
 taaaaccaaggtaaattattgtttcatcttcacgtatggatgctagtgcctttaatggaa       c.*180

          .         .         .         .         .         .       g.18307
 ggtaaagaatgttttgctagttagaagtacatattgaggttttaatggtggtgatagtga       c.*240

          .         .         .         .         .         .       g.18367
 gttttgtggcaccagctgttttttattttaaactttctgagcatccggcaaggtacaggt       c.*300

          .         .         .         .         .         .       g.18427
 tttgatgttcaagttttattgggataagatcttttgatcccaaggtcaggtggatggaat       c.*360

          .         .         .         .         .         .       g.18487
 ttttggatttatatttgttccttgagtcttcagggcagtgtctccatgagggttttcctg       c.*420

          .         .         .         .         .         .       g.18547
 ttgaggggcaccacatacaatagtgtgaagtaggtatgaggggcagtcattgtattctat       c.*480

          .         .         .         .         .         .       g.18607
 agtttttttatgtagtctacatttctcagatgtatccccattcggttttattctcagaac       c.*540

          .         .         .         .         .         .       g.18667
 tgttactagactcatgacttggaggccaaaccttaaatccagagatagcagcctcgatag       c.*600

          .         .         .         .         .         .       g.18727
 ggaccttaaaaggattcacaaaaacttttgccacacttggtgcctaggccctgttcctaa       c.*660

          .         .         .         .         .         .       g.18787
 taaccccttctagggccgtttatccaacatttagatgccttcttttccctccctaatttg       c.*720

          .         .         .         .         .         .       g.18847
 tagccagtccaacctttcattccttggaggatttagttttgggataaaattttggtcctt       c.*780

          .         .         .         .         .         .       g.18907
 gggcacagagacattcactattaatgaagtaacccttgggcatgactccaatcccagaat       c.*840

          .         .         .         .         .         .       g.18967
 tgctcactgagcgctatgccaccgaagcgttgacctgaacatattagtgcaatccagtcc       c.*900

          .         .         .         .         .         .       g.19027
 agattggacctttgatcctatgtggaagggctgttttttaagaaaaaatttttggtaaac       c.*960

          .         .         .         .         .         .       g.19087
 agtattgtgtaaaattgctttttgtataccaatatatgcatgttttgtgcatgagtagta       c.*1020

          .         .         .         .         .         .       g.19147
 cttgtgttgatactcctgttgatgttaaattactatataatataaacagtatgtgttttt       c.*1080

          .         .         .         .         .         .       g.19207
 atatatcattgtgtaaatttaatataacatatgcagtaataaaccatttgttttactgct       c.*1140

          .         .         .         .                           g.19254
 gttaagtttgttatttgggtataaaaccagatgtttacacctgtaaa                    c.*1187

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center