deleted in esophageal cancer 1 (DEC1) - coding DNA reference sequence

(used for variant description)

(last modified August 31, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_017418.2 in the DEC1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000009.11, covering DEC1 transcript NM_017418.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5039
                      ctattgtttctacctcaccctggcccaggaagacagatc       c.-481

 .         .  | 02      .         .         .         .             g.96406
 tactgaggaaag | ccctgaacactctgcggcttctctgagaaaccctatcgaaggggatgt    c.-421

 .         .         .         .         .         .                g.96466
 ggaatcccagagctactcttgctatcaactcgccgcatgaccttgggaaaatcatttcac       c.-361

 .         .         .         .         .         .   | 03         g.154971
 ctggttcagcaatgatttactgagctattgaaggccttactttccagatccag | atccttg    c.-301

 .         .         .         .         .         .                g.155031
 tgcatacaactgacttgtgtgggtgaggcttgcagaaaaaatcagctagaacagccttgg       c.-241

 .         .         .         .         .         .                g.155091
 gggtagtggcaaggtggccagagcaattgactgggagctgggaacaggaatgaagaggaa       c.-181

 .         .         .        | 04.         .         .             g.169120
 gagctgataagaaacatgcccagagcag | atttgatgctactgccaatgtacctgaataag    c.-121

 .         .         .         .         .         .         | 05    g.239825
 aagacaactctttctggaaaaagggaaaacttgaagggctattgaaggccgctagaaag | t    c.-61

 .         .         .         .         .         .                g.239885
 acagaaggaactttggatgtgggagagaaagacaaggagaaacctgaaagcagcccagtt       c.-1

          .    | 06    .         .         .         .         .    g.263588
 ATGACAATGAATG | TTCTGGAGGCTGGGAAGTGGAAGAGCATTGTGCCAGCACCTGGTGAG    c.60
 M  T  M  N  V |   L  E  A  G  K  W  K  S  I  V  P  A  P  G  E      p.20

          .         .        | 07.         .         .         .    g.264408
 GGCCTTCTTGCCGTGTTACACATGATG | GTTTTTACTGATGCCCTGCACAGAGAGAGGTCT    c.120
 G  L  L  A  V  L  H  M  M   | V  F  T  D  A  L  H  R  E  R  S      p.40

          .         .         .         .         .         .       g.264468
 GTAAAGTGGCAAGCAGGAGTCTGCTACAATGGAGGAAAGGATTTTGCTGTATCTCTTGCC       c.180
 V  K  W  Q  A  G  V  C  Y  N  G  G  K  D  F  A  V  S  L  A         p.60

          .         .      | 08  .                                  g.265335
 AGGCCCAAGGCTGCAGAGGGAATTG | CAGATTGA                               c.213
 R  P  K  A  A  E  G  I  A |   D  X                                 p.70

          .         .         .         .         .         .       g.265395
 atgtaagtgacttggaaaaggaagaggagttgccagaaacagctaaaatgtcagtagaag       c.*60

          .         .         .         .         .         .       g.265455
 acttgacagcttgagaatagaggaaaaaataaaagcgaagcagacaaaaagaaccttacc       c.*120

          .         .         .         .         .         .       g.265515
 tcccccacaatacaacattgggctgctgaacccacaaaaatctaaatccgtttagaatca       c.*180

          .         .         .         .         .         .       g.265575
 tctatttaactcctcagagacatgcacaaactattctagagaggcttgtgcctacgaaga       c.*240

          .         .         .         .         .         .       g.265635
 ttacttaagaatgtgttgacacatttggagggggttaatttaccagttatcatttactag       c.*300

          .         .         .         .         .         .       g.265695
 aaaggctttttctataagaatatatgaaagagtttcctcggagcattcaaccgggcttct       c.*360

          .         .         .         .         .         .       g.265755
 ttgtagggtatgtgtactgcttggagctacggaagaccacgtcctagaagtgctgtgtcc       c.*420

          .         .         .         .         .         .       g.265815
 ctgaggcacacctatgtgtgttatctctctggcatactttccaacaaggattcttttcta       c.*480

          .         .         .                                     g.265854
 gtctatacattctgattaatttgcagtcagaggcaatgc                            c.*519

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Deleted in esophageal cancer 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.