7-dehydrocholesterol reductase (DHCR7) - coding DNA reference sequence

(used for variant description)

(last modified December 20, 2013)


This file was created to facilitate the description of sequence variants on transcript NM_001360.2 in the DHCR7 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_012655.2, covering DHCR7 transcript NM_001360.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5033
                            aatcgctgacatcatccgggggcgggcgcccct       c.-241

 .         .         .         .         .         .                g.5093
 gccctgcgggtgactccgacccctggctagagggtaggcggcgtggagcagcgcgcgcaa       c.-181

 .         .         .         .         .         | 02             g.5708
 gcgaggccaggggaaggtgggcgcaggtgaggggccgaggtgtgcgcag | gactttagccg    c.-121

 .         .         .         .         .         .                g.5768
 gttgagaaggatcaagcaggcatttggagcacaggtgtctagaaacttttaaggggccgg       c.-61

 .         .         .         .         .         .    | 03        g.8479
 ttcaagaaggaaaagttcccttctgctgtgaaactatttggcaagaggctggag | ggccca    c.-1

          .         .         .         .         .         .       g.8539
 ATGGCTGCAAAATCGCAACCCAACATTCCCAAAGCCAAGAGTCTAGATGGCGTCACCAAT       c.60
 M  A  A  K  S  Q  P  N  I  P  K  A  K  S  L  D  G  V  T  N         p.20

          .         .         .         | 04         .         .    g.9238
 GACAGAACCGCATCTCAAGGGCAGTGGGGCCGTGCCTG | GGAGGTGGACTGGTTTTCACTG    c.120
 D  R  T  A  S  Q  G  Q  W  G  R  A  W  |  E  V  D  W  F  S  L      p.40

          .         .         .         .         .         .       g.9298
 GCGAGCGTCATCTTCCTACTGCTGTTCGCCCCCTTCATCGTCTACTACTTCATCATGGCT       c.180
 A  S  V  I  F  L  L  L  F  A  P  F  I  V  Y  Y  F  I  M  A         p.60

          .         .         .         .         .         .       g.9358
 TGTGACCAGTACAGCTGCGCCCTGACTGGCCCTGTGGTGGACATCGTCACCGGACATGCT       c.240
 C  D  Q  Y  S  C  A  L  T  G  P  V  V  D  I  V  T  G  H  A         p.80

          .         .         .         .         .         .       g.9418
 CGGCTCTCGGACATCTGGGCCAAGACTCCACCTATAACGAGGAAAGCCGCCCAGCTCTAT       c.300
 R  L  S  D  I  W  A  K  T  P  P  I  T  R  K  A  A  Q  L  Y         p.100

          .         .  | 05      .         .         .         .    g.11117
 ACCTTGTGGGTCACCTTCCAG | GTGCTTCTGTACACGTCTCTCCCTGACTTCTGCCATAAG    c.360
 T  L  W  V  T  F  Q   | V  L  L  Y  T  S  L  P  D  F  C  H  K      p.120

          .         .         .         .         .   | 06     .    g.11999
 TTTCTACCCGGCTACGTAGGAGGCATCCAGGAGGGGGCCGTGACTCCTGCAG | GGGTTGTG    c.420
 F  L  P  G  Y  V  G  G  I  Q  E  G  A  V  T  P  A  G |   V  V      p.140

          .         .         .         .         .         .       g.12059
 AACAAGTATCAGATCAATGGCCTGCAAGCCTGGCTCCTCACGCACCTGCTCTGGTTTGCA       c.480
 N  K  Y  Q  I  N  G  L  Q  A  W  L  L  T  H  L  L  W  F  A         p.160

          .         .         .         .         .         .       g.12119
 AACGCTCATCTCCTGTCCTGGTTCTCGCCCACCATCATCTTCGACAACTGGATCCCACTG       c.540
 N  A  H  L  L  S  W  F  S  P  T  I  I  F  D  N  W  I  P  L         p.180

          .         .         .         .         .         .       g.12179
 CTGTGGTGCGCCAACATCCTTGGCTATGCCGTCTCCACCTTCGCCATGGTCAAGGGCTAC       c.600
 L  W  C  A  N  I  L  G  Y  A  V  S  T  F  A  M  V  K  G  Y         p.200

          .         .       | 07 .         .         .         .    g.14382
 TTCTTCCCCACCAGCGCCAGAGACTG | CAAATTCACAGGCAATTTCTTTTACAACTACATG    c.660
 F  F  P  T  S  A  R  D  C  |  K  F  T  G  N  F  F  Y  N  Y  M      p.220

          .         .         .         .         .         .       g.14442
 ATGGGCATCGAGTTTAACCCTCGGATCGGGAAGTGGTTTGACTTCAAGCTGTTCTTCAAT       c.720
 M  G  I  E  F  N  P  R  I  G  K  W  F  D  F  K  L  F  F  N         p.240

          .         .         .         .         .         .       g.14502
 GGGCGCCCCGGGATCGTCGCCTGGACCCTCATCAACCTGTCCTTCGCAGCGAAGCAGCGG       c.780
 G  R  P  G  I  V  A  W  T  L  I  N  L  S  F  A  A  K  Q  R         p.260

          .         .         .         .         .  | 08      .    g.15497
 GAGCTCCACAGCCATGTGACCAATGCCATGGTCCTGGTCAACGTCCTGCAG | GCCATCTAC    c.840
 E  L  H  S  H  V  T  N  A  M  V  L  V  N  V  L  Q   | A  I  Y      p.280

          .         .         .         .         .         .       g.15557
 GTGATTGACTTCTTCTGGAACGAAACCTGGTACCTGAAGACCATTGACATCTGCCATGAC       c.900
 V  I  D  F  F  W  N  E  T  W  Y  L  K  T  I  D  I  C  H  D         p.300

          .         .         .         .         .         .       g.15617
 CACTTCGGGTGGTACCTGGGCTGGGGCGACTGTGTCTGGCTGCCTTATCTTTACACGCTG       c.960
 H  F  G  W  Y  L  G  W  G  D  C  V  W  L  P  Y  L  Y  T  L         p.320

     | 09    .         .         .         .         .         .    g.17649
 CAG | GGTCTGTACTTGGTGTACCACCCCGTGCAGCTGTCCACCCCGCACGCCGTGGGCGTC    c.1020
 Q   | G  L  Y  L  V  Y  H  P  V  Q  L  S  T  P  H  A  V  G  V      p.340

          .         .         .         .         .         .       g.17709
 CTGCTGCTGGGCCTGGTGGGCTACTACATCTTCCGGGTGGCCAACCACCAGAAGGACCTG       c.1080
 L  L  L  G  L  V  G  Y  Y  I  F  R  V  A  N  H  Q  K  D  L         p.360

          .         .         .         .         .         .       g.17769
 TTCCGCCGCACGGATGGGCGCTGCCTCATCTGGGGCAGGAAGCCCAAGGTCATCGAGTGC       c.1140
 F  R  R  T  D  G  R  C  L  I  W  G  R  K  P  K  V  I  E  C         p.380

          .         .         .         .         .         .       g.17829
 TCCTACACATCCGCCGATGGGCAGAGGCACCACAGCAAGCTGCTGGTGTCGGGCTTCTGG       c.1200
 S  Y  T  S  A  D  G  Q  R  H  H  S  K  L  L  V  S  G  F  W         p.400

          .         .         .         .         .         .       g.17889
 GGCGTGGCCCGCCACTTCAACTACGTCGGCGACCTGATGGGCAGCCTGGCCTACTGCCTG       c.1260
 G  V  A  R  H  F  N  Y  V  G  D  L  M  G  S  L  A  Y  C  L         p.420

          .         .         .         .         .         .       g.17949
 GCCTGTGGCGGCGGCCACCTGCTGCCCTACTTCTACATCATCTACATGGCCATCCTGCTG       c.1320
 A  C  G  G  G  H  L  L  P  Y  F  Y  I  I  Y  M  A  I  L  L         p.440

          .         .         .         .         .         .       g.18009
 ACCCACCGCTGCCTCCGGGACGAGCACCGCTGCGCCAGCAAGTACGGCCGGGACTGGGAG       c.1380
 T  H  R  C  L  R  D  E  H  R  C  A  S  K  Y  G  R  D  W  E         p.460

          .         .         .         .                           g.18057
 CGCTACACCGCCGCAGTGCCTTACCGCCTGCTGCCTGGAATCTTCTAA                   c.1428
 R  Y  T  A  A  V  P  Y  R  L  L  P  G  I  F  X                     p.475

          .         .         .         .         .         .       g.18117
 gggcacgccctagggagaagccctgtggggctgtcaagagcgtgttctgccaggtccatg       c.*60

          .         .         .         .         .         .       g.18177
 ggggctggcatcccagctccaactcgaggagcctcagtttcctcatctgtaaactggaga       c.*120

          .         .         .         .         .         .       g.18237
 gagcccagcacttggcaggtgtccagtacctaatcacgctctgttccttgcttttgcctt       c.*180

          .         .         .         .         .         .       g.18297
 caagggaattccgagtgtccagcactgccgtattgccagcacagacggattttctctaat       c.*240

          .         .         .         .         .         .       g.18357
 cagtgtccctggggcaggaggatgacccagtcacctttactagtcctttggagacaattt       c.*300

          .         .         .         .         .         .       g.18417
 acctgtattaggagcccaggccacgctacactctgcccacactggtgagcaggaggtctt       c.*360

          .         .         .         .         .         .       g.18477
 cccacgccctgtcattaggctgcatttactcttgctaaataaaagtgggagtggggcgtg       c.*420

          .         .         .         .         .         .       g.18537
 cgcgttatccatgtattgcctttcagctctagatccccctcccctgcctgctctgcagtc       c.*480

          .         .         .         .         .         .       g.18597
 gtgggtggggcccgtgcgccgtttctccttggtagcgtgcacggtgttgaactgggacac       c.*540

          .         .         .         .         .         .       g.18657
 tggggagaaaggggctttcatgtcgtttccttcctgctcctgctgcacagctgccaggag       c.*600

          .         .         .         .         .         .       g.18717
 tgctctgcctggagtctgcagacctcagagaggtcccagcaccggctgtggcctttcagg       c.*660

          .         .         .         .         .         .       g.18777
 tgtaggcaggtgggctctgcttcccgattccctgtgagcgcccaccctctcgaaagaatt       c.*720

          .         .         .         .         .         .       g.18837
 ttctgcttgccctatgactgtgcagactctggctcgagcaacccggggaacttcaccctc       c.*780

          .         .         .         .         .         .       g.18897
 aggggcctcccacaccttctccagcgaggaggtctcagtcccagcctcgggagggcacct       c.*840

          .         .         .         .         .         .       g.18957
 ccttttctgtgctttcttccctgaggcattcttcctcatccctagggtgttgtgtagaac       c.*900

          .         .         .         .         .         .       g.19017
 tctttttaaactctatgctccgagtagagttcatctttatattaaacttcccctgttcaa       c.*960

                                                                    g.19021
 ataa                                                               c.*964

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The 7-dehydrocholesterol reductase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 08
©2004-2013 Leiden University Medical Center