DEAH (Asp-Glu-Ala-His) box polypeptide 30 (DHX30) - coding DNA reference sequence

(used for variant description)

(last modified September 8, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_138615.2 in the DHX30 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000003.11, covering DHX30 transcript NM_138615.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5006
                                                       ccgcct       c.-421

 .         .         .         .         .         .                g.5066
 gcaccgccgccgcgccccattgggccgggtgctggggcatcccgggcgctgggtgccccg       c.-361

 .         .         .         .         .         .                g.5126
 agcggctacgacgagtcccaggtggggccgggctccaggcccgcgggggagcggagccgt       c.-301

 .         .         .         .         .         .                g.5186
 gcgccgcaggcgggctccgtgacgccgggtggggaacgccgggccggtggcgggacttcc       c.-241

 .         .         .         .         .         .                g.5246
 gccacgggactcggaaggggccgcgccgccgctgctgggagttgtagtccggccgtggtt       c.-181

 .         .         .         .         .         .        | 02    g.7419
 gggggagccgcggctcatgcgcggtgcacagaggcttgtttcacatctgtaacaacag | ga    c.-121

 .         .         .         .         .         .                g.7479
 ggaggcccagcctcgtgatgaggaatagcaaggagagaattcagctccagttcaaaagcc       c.-61

 .         .         .         .   | 03     .         .             g.12775
 tacaaaatctgagactgtcattgcttttataag | gattccagctttccctcctggccagaa    c.-1

          .         .         | 04         .         .         .    g.20145
 ATGTTCAGCCTGGACTCATTCAGAAAAG | ATCGGGCCCAGCACAGGCAGCGTCAGTGCAAA    c.60
 M  F  S  L  D  S  F  R  K  D |   R  A  Q  H  R  Q  R  Q  C  K      p.20

          .         .         .         .         .         .       g.20205
 CTTCCCCCACCCCGCCTTCCACCCATGTGTGTCAACCCTACCCCAGGAGGGACCATCTCT       c.120
 L  P  P  P  R  L  P  P  M  C  V  N  P  T  P  G  G  T  I  S         p.40

      | 05   .         .         .         .         .         .    g.29494
 CGAG | CTTCTAGGGACCTATTAAAAGAGTTCCCACAGCCCAAAAATCTTCTCAACAGTGTG    c.180
 R  A |   S  R  D  L  L  K  E  F  P  Q  P  K  N  L  L  N  S  V      p.60

          .         .         .         .         .         .       g.29554
 ATTGGAAGAGCCCTCGGCATCTCACATGCAAAAGACAAACTAGTCTACGTGCACACAAAT       c.240
 I  G  R  A  L  G  I  S  H  A  K  D  K  L  V  Y  V  H  T  N         p.80

          .      | 06  .         .         .         .         .    g.31160
 GGACCGAAGAAAAAG | AAAGTCACACTGCACATAAAATGGCCCAAGAGCGTGGAGGTAGAA    c.300
 G  P  K  K  K   | K  V  T  L  H  I  K  W  P  K  S  V  E  V  E      p.100

          .         .         .         .         .         .       g.31220
 GGCTATGGCAGCAAGAAGATCGATGCTGAGCGGCAGGCTGCAGCTGCAGCCTGCCAGCTG       c.360
 G  Y  G  S  K  K  I  D  A  E  R  Q  A  A  A  A  A  C  Q  L         p.120

        | 07 .         .         .         .         .         .    g.43022
 TTCAAG | GGTTGGGGTCTGCTAGGTCCCCGGAATGAGTTGTTTGACGCAGCCAAATACCGA    c.420
 F  K   | G  W  G  L  L  G  P  R  N  E  L  F  D  A  A  K  Y  R      p.140

          .         .         .         .         .         .       g.43082
 GTGCTAGCTGATCGCTTTGGCTCCCCTGCCGACAGCTGGTGGCGTCCGGAACCCACCATG       c.480
 V  L  A  D  R  F  G  S  P  A  D  S  W  W  R  P  E  P  T  M         p.160

          .         .         .         .         .         .       g.43142
 CCCCCTACTTCCTGGCGGCAGCTGAATCCAGAGAGTATTCGACCAGGGGGACCTGGGGGC       c.540
 P  P  T  S  W  R  Q  L  N  P  E  S  I  R  P  G  G  P  G  G         p.180

          .         .         .         .         .         .       g.43202
 CTATCCCGCTCTTTAGGCCGGGAAGAAGAGGAGGACGAGGAGGAAGAGCTAGAAGAAGGG       c.600
 L  S  R  S  L  G  R  E  E  E  E  D  E  E  E  E  L  E  E  G         p.200

          .         .         .         .         .         .       g.43262
 ACCATAGATGTTACCGACTTCTTGTCCATGACCCAGCAGGATTCCCACGCTCCACTCAGG       c.660
 T  I  D  V  T  D  F  L  S  M  T  Q  Q  D  S  H  A  P  L  R         p.220

          | 08         .         .         .         .         .    g.43760
 GACTCAAG | GGGGAGTTCCTTTGAGATGACAGATGACGACAGTGCCATTAGGGCTCTGACC    c.720
 D  S  R  |  G  S  S  F  E  M  T  D  D  D  S  A  I  R  A  L  T      p.240

          .         .         .         .         .         .       g.43820
 CAGTTTCCACTTCCCAAGAACCTTCTGGCCAAGGTGATTCAGATTGCAACGTCATCCTCC       c.780
 Q  F  P  L  P  K  N  L  L  A  K  V  I  Q  I  A  T  S  S  S         p.260

           | 09        .         .         .         .         .    g.45248
 ACAGCTAAG | AACCTCATGCAGTTCCATACTGTGGGCACCAAGACCAAGCTGTCTACACTC    c.840
 T  A  K   | N  L  M  Q  F  H  T  V  G  T  K  T  K  L  S  T  L      p.280

          .         .         .         .         .         .       g.45308
 ACCCTGCTCTGGCCCTGCCCCATGACCTTTGTTGCCAAAGGGCGCCGCAAAGCAGAGGCT       c.900
 T  L  L  W  P  C  P  M  T  F  V  A  K  G  R  R  K  A  E  A         p.300

          .         .         .          | 10        .         .    g.47812
 GAGAATAAGGCGGCAGCCTTGGCCTGCAAGAAACTGAAG | AGCCTGGGCCTGGTGGACAGG    c.960
 E  N  K  A  A  A  L  A  C  K  K  L  K   | S  L  G  L  V  D  R      p.320

          .         .         .         .         .         .       g.47872
 AACAACGAACCGCTTACACACGCCATGTATAACCTGGCCTCTTTGCGTGAGCTGGGTGAG       c.1020
 N  N  E  P  L  T  H  A  M  Y  N  L  A  S  L  R  E  L  G  E         p.340

          .         .         .         .         .         .       g.47932
 ACCCAGCGCCGACCATGCACCATCCAGGTGCCCGAGCCCATCCTCCGCAAGATAGAGACC       c.1080
 T  Q  R  R  P  C  T  I  Q  V  P  E  P  I  L  R  K  I  E  T         p.360

          .   | 11     .         .         .         .         .    g.48304
 TTCCTGAACCAT | TACCCTGTGGAGAGTTCATGGATCGCCCCAGAACTCCGGCTGCAGAGT    c.1140
 F  L  N  H   | Y  P  V  E  S  S  W  I  A  P  E  L  R  L  Q  S      p.380

          .         .         .         .         .         .       g.48364
 GATGACATCTTGCCCTTGGGCAAGGACTCAGGGCCTCTGAGTGACCCTATCACAGGCAAG       c.1200
 D  D  I  L  P  L  G  K  D  S  G  P  L  S  D  P  I  T  G  K         p.400

          .         .         .         .         .         .       g.48424
 CCCTATGTGCCCCTGTTGGAAGCAGAGGAGGTACGTCTCAGCCAGAGTCTGCTAGAACTG       c.1260
 P  Y  V  P  L  L  E  A  E  E  V  R  L  S  Q  S  L  L  E  L         p.420

          .         .         .         .         .         .       g.48484
 TGGCGGCGGCGAGGGCCGGTCTGGCAGGAGGCCCCCCAGCTACCTGTGGACCCACATCGG       c.1320
 W  R  R  R  G  P  V  W  Q  E  A  P  Q  L  P  V  D  P  H  R         p.440

          .         .         .         .         .         .       g.48544
 GACACCATCCTCAACGCCATTGAGCAGCACCCGGTGGTGGTCATCTCTGGGGACACGGGC       c.1380
 D  T  I  L  N  A  I  E  Q  H  P  V  V  V  I  S  G  D  T  G         p.460

          .         .         .         .         .         .       g.48604
 TGTGGGAAGACCACGCGCATCCCCCAGCTGTTGCTGGAGCGCTATGTGACCGAGGGCCGA       c.1440
 C  G  K  T  T  R  I  P  Q  L  L  L  E  R  Y  V  T  E  G  R         p.480

          .         .         .         .         .         .       g.48664
 GGTGCCCGCTGCAATGTTATCATCACCCAACCTCGCCGCATCTCTGCTGTGTCTGTGGCA       c.1500
 G  A  R  C  N  V  I  I  T  Q  P  R  R  I  S  A  V  S  V  A         p.500

          .         .         .         .         .         .       g.48724
 CAGCGGGTCAGCCACGAACTGGGCCCCTCCCTGCGCCGGAATGTGGGCTTCCAGGTGCGG       c.1560
 Q  R  V  S  H  E  L  G  P  S  L  R  R  N  V  G  F  Q  V  R         p.520

          .         .         .         .         .         .       g.48784
 TTGGAAAGTAAGCCCCCATCCCGAGGCGGGGCCCTGCTCTTCTGCACTGTGGGTATCCTG       c.1620
 L  E  S  K  P  P  S  R  G  G  A  L  L  F  C  T  V  G  I  L         p.540

          .         .         .         .         .         .       g.48844
 CTGCGTAAGCTGCAGAGCAACCCCAGCCTGGAGGGCGTGAGCCACGTCATCGTGGATGAG       c.1680
 L  R  K  L  Q  S  N  P  S  L  E  G  V  S  H  V  I  V  D  E         p.560

          .         .         .         .         .         .       g.48904
 GTGCATGAGCGGGACGTGAACACAGACTTTCTGCTGATCCTGCTCAAGGGCCTGCAGCGG       c.1740
 V  H  E  R  D  V  N  T  D  F  L  L  I  L  L  K  G  L  Q  R         p.580

          .         .         .         .         .         .       g.48964
 CTCAACCCGGCCCTGCGGCTGGTGCTCATGAGTGCCACAGGGGACAATGAGCGCTTCTCC       c.1800
 L  N  P  A  L  R  L  V  L  M  S  A  T  G  D  N  E  R  F  S         p.600

          .         .         .         .         .         .       g.49024
 CGATACTTTGGTGGCTGCCCCGTCATCAAGGTGCCTGGCTTCATGTACCCAGTCAAGGAG       c.1860
 R  Y  F  G  G  C  P  V  I  K  V  P  G  F  M  Y  P  V  K  E         p.620

          .         .         .         .         .         .       g.49084
 CACTACCTAGAGGACATCCTGGCCAAGTTGGGCAAGCACCAGTACCTGCACCGGCACCGG       c.1920
 H  Y  L  E  D  I  L  A  K  L  G  K  H  Q  Y  L  H  R  H  R         p.640

           | 12        .         .         .         .         .    g.49415
 CACCATGAG | TCTGAGGATGAATGCGCACTCGATTTGGACCTTGTGACTGATCTGGTTCTG    c.1980
 H  H  E   | S  E  D  E  C  A  L  D  L  D  L  V  T  D  L  V  L      p.660

          .         .      | 13  .         .         .         .    g.49558
 CACATCGATGCTCGCGGGGAACCAG | GTGGGATCCTGTGCTTCCTGCCTGGGTGGCAGGAG    c.2040
 H  I  D  A  R  G  E  P  G |   G  I  L  C  F  L  P  G  W  Q  E      p.680

          .         .         .         .         .         .       g.49618
 ATCAAAGGAGTGCAGCAGCGCCTCCAGGAGGCCCTGGGCATGCACGAGAGCAAGTACCTC       c.2100
 I  K  G  V  Q  Q  R  L  Q  E  A  L  G  M  H  E  S  K  Y  L         p.700

          . | 14       .         .         .         .         .    g.49922
 ATCCTGCCAG | TGCACTCCAACATCCCCATGATGGATCAGAAGGCCATATTCCAGCAGCCT    c.2160
 I  L  P  V |   H  S  N  I  P  M  M  D  Q  K  A  I  F  Q  Q  P      p.720

          .         .         .         .         .         .       g.49982
 CCAGTTGGGGTGCGCAAGATTGTCTTGGCCACCAACATTGCTGAGACTTCCATCACAATC       c.2220
 P  V  G  V  R  K  I  V  L  A  T  N  I  A  E  T  S  I  T  I         p.740

          .         .         .         .         .         .       g.50042
 AATGACATCGTGCATGTGGTGGACAGTGGGCTGCACAAGGAAGAACGCTATGACCTGAAG       c.2280
 N  D  I  V  H  V  V  D  S  G  L  H  K  E  E  R  Y  D  L  K         p.760

        | 15 .         .         .         .         .         .    g.50325
 ACCAAG | GTGTCCTGCCTGGAGACAGTGTGGGTATCAAGAGCCAATGTGATCCAGCGCCGG    c.2340
 T  K   | V  S  C  L  E  T  V  W  V  S  R  A  N  V  I  Q  R  R      p.780

          .         .         .         .         .         .       g.50385
 GGCCGGGCGGGCCGCTGCCAGTCCGGCTTTGCCTACCACTTGTTCCCTCGAAGCCGGCTG       c.2400
 G  R  A  G  R  C  Q  S  G  F  A  Y  H  L  F  P  R  S  R  L         p.800

          .         .         .         .         .         .       g.50445
 GAGAAAATGGTCCCTTTCCAAGTGCCAGAGATCCTGCGCACACCTCTTGAGAACCTGGTG       c.2460
 E  K  M  V  P  F  Q  V  P  E  I  L  R  T  P  L  E  N  L  V         p.820

          .         .         .    | 16    .         .         .    g.50587
 CTGCAAGCGAAAATCCACATGCCTGAGAAGACG | GCGGTGGAGTTCCTGTCCAAGGCTGTG    c.2520
 L  Q  A  K  I  H  M  P  E  K  T   | A  V  E  F  L  S  K  A  V      p.840

          .         .         .         .         .      | 17  .    g.50720
 GACAGTCCAAACATCAAGGCAGTGGACGAGGCTGTGATCTTGCTCCAGGAGATCG | GGGTG    c.2580
 D  S  P  N  I  K  A  V  D  E  A  V  I  L  L  Q  E  I  G |   V      p.860

          .         .         .         .         .         .       g.50780
 CTGGACCAGCGGGAGTACCTGACTACCCTGGGGCAGCGCCTGGCTCACATCTCCACCGAC       c.2640
 L  D  Q  R  E  Y  L  T  T  L  G  Q  R  L  A  H  I  S  T  D         p.880

          .         .         .         .         .         .       g.50840
 CCCCGGTTGGCCAAGGCCATTGTGTTGGCTGCCATCTTCCGTTGCCTGCACCCACTACTG       c.2700
 P  R  L  A  K  A  I  V  L  A  A  I  F  R  C  L  H  P  L  L         p.900

          .         .         .         .         .         .       g.50900
 GTGGTCGTTTCCTGCCTCACCCGGGACCCCTTCAGCAGCAGCCTACAGAACCGGGCAGAG       c.2760
 V  V  V  S  C  L  T  R  D  P  F  S  S  S  L  Q  N  R  A  E         p.920

           | 18        .         .         .         .         .    g.51062
 GTGGACAAG | GTGAAAGCACTGTTGAGCCATGACAGCGGCAGTGACCACCTGGCCTTTGTG    c.2820
 V  D  K   | V  K  A  L  L  S  H  D  S  G  S  D  H  L  A  F  V      p.940

          .         .         .         .         .         .       g.51122
 CGGGCTGTCGCCGGCTGGGAGGAGGTGCTGCGTTGGCAGGACCGCAGCTCCCGGGAGAAT       c.2880
 R  A  V  A  G  W  E  E  V  L  R  W  Q  D  R  S  S  R  E  N         p.960

          .         .         .         .          | 19        .    g.51294
 TACCTGGAGGAAAACCTGCTGTACGCACCCAGCCTGCGCTTCATCCACG | GACTCATCAAG    c.2940
 Y  L  E  E  N  L  L  Y  A  P  S  L  R  F  I  H  G |   L  I  K      p.980

          .         .         .         .         .         .       g.51354
 CAGTTCTCAGAGAACATTTATGAGGCCTTCCTGGTGGGGAAGCCCTCGGACTGCACCCTG       c.3000
 Q  F  S  E  N  I  Y  E  A  F  L  V  G  K  P  S  D  C  T  L         p.1000

          .         .         .         .         .         .       g.51414
 GCCTCCGCCCAGTGCAACGAGTACAGTGAGGAGGAGGAGCTGGTGAAGGGCGTGCTGATG       c.3060
 A  S  A  Q  C  N  E  Y  S  E  E  E  E  L  V  K  G  V  L  M         p.1020

          .         .        | 20.         .         .         .    g.51575
 GCCGGCCTCTACCCCAACCTCATCCAG | GTGAGGCAGGGCAAGGTCACCCGGCAGGGGAAG    c.3120
 A  G  L  Y  P  N  L  I  Q   | V  R  Q  G  K  V  T  R  Q  G  K      p.1040

          .         .         .         .         .         .       g.51635
 TTCAAGCCCAACAGCGTCACATATAGGACCAAATCAGGCAACATCCTGCTGCACAAGTCG       c.3180
 F  K  P  N  S  V  T  Y  R  T  K  S  G  N  I  L  L  H  K  S         p.1060

          .  | 21      .         .         .         .         .    g.51770
 ACCATTAACAG | GGAGGCCACACGGTTACGGAGCCGATGGCTGACGTATTTCATGGCAGTC    c.3240
 T  I  N  R  |  E  A  T  R  L  R  S  R  W  L  T  Y  F  M  A  V      p.1080

          .         .         .         .         .         .       g.51830
 AAGTCCAATGGCAGCGTCTTCGTCCGGGACTCCTCTCAGGTGCACCCGCTAGCTGTGCTG       c.3300
 K  S  N  G  S  V  F  V  R  D  S  S  Q  V  H  P  L  A  V  L         p.1100

          .         .         .  | 22      .         .         .    g.51987
 CTGCTGACCGACGGGGACGTGCACATCCGTG | ATGACGGGCGCCGGGCCACCATCTCACTG    c.3360
 L  L  T  D  G  D  V  H  I  R  D |   D  G  R  R  A  T  I  S  L      p.1120

          .         .         .         .         .         .       g.52047
 AGCGACAGTGACCTGCTGCGGCTGGAGGGTGACTCGCGTACCGTGCGGCTGCTGAAGGAG       c.3420
 S  D  S  D  L  L  R  L  E  G  D  S  R  T  V  R  L  L  K  E         p.1140

          .         .         .         .         .         .       g.52107
 CTGCGGCGGGCCCTGGGCCGCATGGTGGAGCGGAGCCTGCGCAGCGAGCTGGCTGCACTT       c.3480
 L  R  R  A  L  G  R  M  V  E  R  S  L  R  S  E  L  A  A  L         p.1160

          .         .         .         .         .         .       g.52167
 CCCCCCAGCGTACAGGAGGAGCACGGGCAGCTGCTTGCGCTACTGGCAGAGCTGCTGCGA       c.3540
 P  P  S  V  Q  E  E  H  G  Q  L  L  A  L  L  A  E  L  L  R         p.1180

          .         .         .         .                           g.52212
 GGACCCTGTGGCAGCTTTGATGTGCGCAAGACAGCTGACGACTGA                      c.3585
 G  P  C  G  S  F  D  V  R  K  T  A  D  D  X                        p.1194

          .         .         .         .         .         .       g.52272
 gccctgcttctgctggggctgtgtacagagtgcaaatgtttatttaaaataaagttctat       c.*60

          .                                                         g.52288
 ttatcccttgtgacca                                                   c.*76

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The DEAH (Asp-Glu-Ala-His) box polypeptide 30 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19a
©2004-2017 Leiden University Medical Center